Specimen 8357

Species "monothalamids" > Clade C4 > Leptammina > Leptammina grisea
Isolate number 8357
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4794-4805m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.31, -36.36

Barcode sequence

SSU partial

>Saccaminidae sp. JP-2008b | genomic DNA | 8357 | depth 4794-4805m, using an agassiz trawl | taxon:558414 | 22 | Antarctica:Southern Ocean, Weddell Sea | 65.52 S 36.61 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgtgctttgtaactttttttaagttgcttacacaacaacaaattatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatcagggaccatgtttatttatgtactttcttactcgctttttaagcactttttgtgttttttaagcttgtactttagtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttgagttgtttacacttctcataacataagaggctttcctaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgactcttttacgagggaaagacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatatatatttttttgtgatttctttaattaagcgagcacacaatatgtctgctctctcgccctgtctgtagtcttttgtagttttctttttttaaagtctgctctcaagctcagattgtgttttgtgggagtgtgtttgtcttttactttagcgtgtgtcttgtatttatatgaggtgcattgtctttagtcttaaagcaactatcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattattggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcttactcttatgtcaagcaaacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI