Specimen 8010

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 8010
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 108m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.29

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 8010 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.09 S 58.29 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccacgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI