Specimen 3623

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 3623
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 2002
Habitat soft sediment
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Epistominella exigua | genomic DNA | 3623 | J. Pawlowski 3623 (UniGE) | taxon:349561 | small subunit ribosomal RNA gattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgcgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgc

See sequence on NCBI