Specimen 322

Species Miliolida > Peneroplidae > Dendritina > Dendritina zhengae
Isolate number 322
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on November 1996
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgataggattattatatttataataattcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatataattatataatagtattatatattgttactaacataatattgtgcatcctatatatattatataggattttaagtgaacatattatattatgtattacatatatatatatattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataacgtatagtatagcataaaattaaaggaaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatttatatatatattaattctaatatattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattacttattatactacattttcttggtagtattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatataagggacataaacattatataatattgaaacttacatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Dendritina zhengae | genomic DNA | 322 | taxon:128063 | Japan: Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacgttatttcaaataatatattatatatatttggataactaagggaaagtttggctaatacatatgtcttattgcatataatggttaatatatgattaacattatataaatattatgtacttttgtacaatttatagagcagactttatataattattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgatatatattaccttgtatacttactcaatatgtatattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtcgctttgtataatttattatacattgcttgataatataccaatgttataaaatattgaatttgaatgcggtgattctaataatttcaagtaacatgtatattatatgttatctgaatattcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcctatacaatcattgttgcggttaagaggctcgtagttggattgaataatgaatatacatacataatactgtgaacaaaccagagtgtataaaacatgtaataaataattattattagcaatgaatgttttatcatgggatattgcaataatatttcgatggagatagttggagttgagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattatactctttgtatattccatagcaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaataaacatgaatgtttataatccttcaatatatattatacatttatagttgagttataagttataactcctataatatatattattaatattgaatttttaaatattttcataatatatatgattatatgtactttgcgctcatatatttattccggtgagatgtaagcattataggagagtaatattacacatctgtaattattataatcctaatttaaaaacgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaatagtaccctcctggggtagtatgcacgcaagtgtgaaactnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgataggattattatatttataataattcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatataattatataatagtattatatattgttactaacataatattgtgcatcctatatatattatataggattttaagtgaacatattatattatgtattacatatatatatatattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataacgtatagtatagcataaaattaaaggaaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatttatatatatattaattctaatatattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattacttattatactacattttcttggtagtattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatataagggacataaacattatataatattgaaacttacatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI