Specimen 5222

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 5222
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on February 2005
Habitat soft sediment
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Epistominella exigua | genomic DNA | 5222 | taxon:349561 | small subunit ribosomal RNA caagtggttatattaacccgacagtttaaataagtgttaaatgctacattaaacttatacacactcacgcacacacaccatacgattttgtttacggtagtaacaatttcagcgtgaatcacttcttacacgcagtgaatcactggaatttacacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtcattttaaaaatttccttattcggaacacctgctcgcaggcttacgggtggatttttttatatcgacttttgtcgtgcatacccacgcatttcaaaattcattttgatttctctgtatcgcttattctctaaggacatgcgttacaccgtgacaattttcttttatggataactcagggaaagtttggctaatacgtacgagtacatataccacacacacacacacacgatacaaaatttattttgttttgctgcgtgtatcgacacaccacacacacacacacacacttactactcagcactcaatggtaaactttggccgcgttcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgttccttcgggagcttcacatcacgctgagcagactttgcgaagtttacttcgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatctatttataaattgtaacattaccatgcgttaacaatttacaacataacaagtttattacacatatagcactatatttttttctgtcacacagagaagacatccttgttcgttgtttattcagcatataagctattattttatattagttttttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttcgtgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaaatttgaatgaattctcgtatccattctattttttgttatagttttacgcattatcaaattcacgtttgtattttgcgttcgacgctcgttaaaaatttacacacacacacttttttttttacgcggcactcgaatttttaccgtagcgtatatacgtacattctacacacacacacttatttacgtatatatgcactcacgcggtaattatttgagagaactatatcactcgcttaaaatttattctcctttcaacactgtgaacaaatcaaagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcacttccgccttaaagaaaattattgcaattttttcgccacacacacaccatgcgtacatgttatatatatttcgcagccacgtaaaattctgttattttctttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagcggtgaaatgcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatgcgtataagagtcacacgtatatttttttacacacacacacacgcacaaaaattttatacgctctctctccattacgcatcaatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcagcctacaaaatgacttggcttgagctcgtatttttatacgctcgcctaacttttttcgtatggtctcgatggacgtttcatttatatttttttgcgtgtaagcattatgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactgtgtcatactgcccgcagcgtataccctcgggtatttcgtctgtcgtgtgcagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgcgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaagggaagagaagtcgaacaaggca

See sequence on NCBI