Specimen 5191

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 5191
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on February 2005
Habitat soft sediment
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Epistominella exigua | genomic DNA | 5191 | seawater, depth:4803m | taxon:349561 | Antarctica:Weddell Sea | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA atttgactcacgcgggaaancttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgcgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI