Specimen 1439

Species "monothalamids" > Clade F > Hemisphaerammina > Hemisphaerammina bradyi
Isolate number 1439
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on June 1999
Habitat Sea grass meadow
Depth <5m
Location Mediterranean Sea, Banuyls, France

Barcode sequence

SSU partial

>Hemisphaerammina bradyi | genomic DNA | 1439 | taxon:159868 | 2 | single cell | France:Banyuls | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgagggttgacaggtgtttcgtaaagttaacggtttagtaattgtttgtgccttcacgggtatttgcttttattgggctttttcatttacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattggcgtgagtgagttattatagttctttcgtgacctcattatttcatttaatatgttattttgattgcgtccggttctatatgcttgccatcgccacgaaggcaacgaacgtgaccgcaacctcttgttgcctcccttgagcattatagttgaaattctcaatttatttgagttatttctttatatttgccacagtcttataagtgattcttttatctttttttaaacggaaaggtatttgtaatttactatatgttttttactgcagtggagggaaactagagggaccgctgacatttcttaaaccagagaaggttgcggcaataacaggtctgtgatgccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatcttacccagttcgtgtgcacagttgcagctttaccatcaagtatgtttctttgtttttgtgcttggtgtttctcttaggagtatatcttgtgcatttgcattgtttcatgctggtaactctctgatgcatttgtttttatttagtaattattgcttagttgtagtgttgctttataatttttataactttaacgactaggctacttcgaaagtaagtagctaatcaattcgaagtaatgatttccttttatttttatattttatagcacaatttacatgtccatagtcttttataggtggcgccttgcgtgttgctttataatgctattgtttggcatgtgctccattaattcgtggtggggacagaccattgttaattgttggtctcgtcttaactaggaatgccttgtacgggtctttggttcaacagaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaagccattaagttatttatttagcttaataatttattctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI