Specimen 3334

Species "monothalamids" > Clade C2 > Bathyallogromia > Bathyallogromia weddellensis
Isolate number 3334
Collector Jan Pawlowski
Identifier Andrew Gooday
Collected on April 2002
Habitat soft sediment
Depth 2002m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.17, -53.23

Barcode sequence

SSU partial

>Foraminiferan sp. W79 | genomic DNA | W79 | taxon:212481 | Antarctica:Weddell Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaataatgtaaagagttggttttatttttttaattctattctctttatatacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggacctgatatatagttgcgtgattttctttcactgctatacagcgtctgcttgatcgacagtttttcatttgtttgtatttatttactctctatttggaagactgctctggtcttctttcgtttgtagtgttaagagaatttgcgtacttctggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctcttacacttgtacgattttactttttctgaatttattcaaaaattgtatttattgtgctaatcaaagagtgctttataaaactagagggaccgctgagccttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattataacactgtagtccaactagtcttttttctgtttattcaggattttgattggttgcgcagtcaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaattagtttttgattttgaataagcacgcaatatactgctctcctcccgggtttctagcaatcttgtctagattccttagtgtgtggagatgtttttcagtatgtgcttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggcaccttagtttgcttttcttttttgaactgcttgctataatcgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacc

See sequence on NCBI