Specimen 6674

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis pertusus
Isolate number 6674
Collector Beatrice Lecroq
Identifier Maria Holzmann
Collected on September 2006
Habitat soft sediment
Location Adriatic Sea, Mavarstica, Ciovo, Croatia

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattattatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgccttatatattatttataaggattttaagtgaacatattttattatacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatatattatttatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctattataatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattcatacatatatggtatattaatattgtataatactatacattttatagtactattacaaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacatacatatcctgaaattgaatatattgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Peneroplis pertusus | genomic DNA | 6674 | marine sediment sample | taxon:46137 | Croatia:Mavarstica | 27-Sep-2006 | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatatagaaatatagttagttatatttggataactaagggaaagtttggctaatacgtttatataatacgtaaatataatatttatagcatattatgatatcattgcaacatgattgacataatataaatatataatacatttatttgtattaatattttgcagactttatagtaattataacttataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgtaattaatatatataatatataccttgtatactgtattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtcnctttgtataatttattatacattgcttgataatataccaatgttataaaatattgaatttgaatgcggtgattttaataatttcaagtaacatgtataaaatagtaatattttatatgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcctatacaatcattgttgcggttaagaggctcgtagttggattgaataattatacatattatatacaatactgtgaacaaaccagagtgtataaaacatgtaatattataattattagcaatgaatgttttatcatgggatattgcaatataattataaatattattgttagttagttatatcgatggagatagttggagttgagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgtaagcncttaactagattatactctttgtatatatataacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatatgtgatacatataatataatattcccttcaacttatattatacatgtatagttgagtacttaatttgtactcctatatatattataaattgaatatttattaattataatcataaatgattatatgtactttgcgctcatattatttaaaaggtgagatgtaagcattataggagagtaatatacttatatcatattatatgtgtataatgtattattataatccttaattaataaacgtaatgngatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattattatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgccttatatattatttataaggattttaagtgaacatattttattatacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatatattatttatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctattataatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattcatacatatatggtatattaatattgtataatactatacattttatagtactattacaaataccattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacatacatatcctgaaattgaatatattgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI