Specimen 3553

Species "monothalamids" > Clade C2 > Bathyallogromia > Bathyallogromia weddellensis
Isolate number 3553
Collector Jan Pawlowski
Identifier Andrew Gooday
Collected on April 2002
Habitat soft sediment
Depth 6326m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -58.5, -23.58

Barcode sequence

SSU partial

>Bathyallogromia weddellensis | genomic DNA | 3553 | taxon:1051364 | 1 | Antarctica | 18S rRNA | 18S rRNA | 18S ribosomal RNA gcgggaaatcttaccgggtccggacacactgaggattgacaggcaataatgtaaagagttggttttatttttttaattctattctctttatatacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggacctgatatatagttgcgtgattttctttcactgctatacagcgtctgcttgatcgacagtttttcatttgtttgtatttatttactctctatttggaagactgctctggtcttctttcgtttgtagtgttaagagaatttgcgtacttctggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctcttacacttgtacgattttactttttctgaatttattcaaaaattgtatttattgtgctaatcaaagagtgctttataaaactagagggaccgctgagccttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattatagcactgtagtccaactagtctttttctgtttattcaggatttgattggttgcgcagtcaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaattagtttttgattttgaataagcacgcaatatactgctctcctcccgggtttctagcaatcttgtctagattccttagtgtgtggagatgtttttcagtatgtgcttttgtcaattcatggtggggacagaccattattaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggcaccttagtttgcttttcttttttgaactgcttgctataatcgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI