Specimen 3339

Species "monothalamids" > Clade C2 > Bathyallogromia > Bathyallogromia weddellensis
Isolate number 3339
Collector Jan Pawlowski
Identifier Andrew Gooday
Collected on April 2002
Habitat soft sediment
Depth 2002m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -65.17, -53.22

Barcode sequence

SSU partial

>Bathyallogromia weddellensis | genomic DNA | 3339 | taxon:1051364 | 1 | Antarctica | 18S rRNA | 18S rRNA | 18S ribosomal RNA actcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataatgtaaagagttggttttatttttttaattctattctctttatatacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggacctgatatatagttgcgtgattttctttcactgctatacagcgtctgcttgatcgacagtttttcatttgtttgtatttatttactctctatttggaagactgctctggtcttctttcgtttgtagtgttaagagaatttgcgtacttctggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctcttacacttgtacgattttactttttctgaatttattcaaaaattgtatttattgtgctaatcaaagagtgctttataaaactagagggaccgctgagccttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattataacactgtagtccaactagtcttttttctgtttattcaggattttgattggttgcgcagtcaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaattagtttttgattttgaataagcacgcaatatactgctctcctcccgggtttctagcaatcttgtctagattccttagtgtgtggagatgtttttcagtatgtgcttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggcaccttagtttgcttttcttttttgaactgcttgctataatcgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI