Specimen C62

E. excavatum A227 E. excavatum A227 E. excavatum A227
Species Rotaliida > Elphidiidae > Elphidium > Elphidium excavatum
Isolate number C62
Collector Loic Pillet
Identifier Loic Pillet
Collected on July 2008
Habitat salt marsh
Depth 0
Location Canada, Chezzetcook Inlet
Latitude, Longitude 44.7045, -63.2545

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgaatttcaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataangtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgagtttcaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgacaggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataatgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgaattttaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcttcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataatgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequences

SSU total

>Elphidium excavatum | genomic DNA | C62.1 | taxon:212501 | SSU | SSU | small subunit ribosomal RNA agccatgcaagtggttattataacccgacagtttaaataagtgtttggtaatgatcagtaacttaaactcactcacgtactcaaaaacgaatatagattactaacgcgatctatatttagtgaaacgcttaccacgttatcacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctaacttttagagacatacactgacactgtatgtacgccaccgcacaaaattatttacacacaaatgtactccaccacgcatggatgtcttttatgcacgcacgcatacgcgttgtaggcaatttgttgatgtagtcgcgctcaattttcaccgcacacaaacgacttatgaccgcaaattatatattagcgaccgcggattttaatcttgccaaaagagctatctttgcaacttgctatagaaccagaccgcactgactgctcgtttgagactttaacgagtctcatatacaagaggttttaaaatgcaactgccaatttgcgcgtcgtacacagtgcgtgtcgcgaggttgattgtcgtgttgggtatatcttcaaataccgtctataaacgtgtgtgtgtgtgtatgtattagatatttgtgcacgcgtgttgtatatacgtccctgtacttatttatgtgtgtgtggtgctatgtacgtgtcgtcgtatgctctctaaaaaaacacacacacaaaataaatgcttttgacggataactcagggaaagtttggctaatacgtacgaactaaaaaaaaaactggnttattgtcgtgttgaattgtcgtgtcaaaaagaaccactctctttgtgtttgacattgtgtctacaacgttcctctctcactaacacacacacaccccttattggaataattgcattcactctcgtcttgcacataaaaccaactcacccaaacggttttgtgttcacgcacacgcgcacatttctcacactttaaaaacgaatatcgcttttcgcgttcagtggttggagtttaccaaacgcaacatgagagacactgaatacgcagtaattaagggacttgcgcccttttttacatacgctgagttgatatgatacgattttctcgtattatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagacggctcttagttctaaggaacgcagcaggcgcgtaaattgtccaataatagtacaatttattcttttaccctaacgaggtaaattaaaaagtacatgtgaattaaattcgctgtatttttaccacaacacaaaccttaaactacgtcgagtaaaaaaataatatattgagacagtgacaagctgtaacggttgagtataataattatgacgagtgtctgacttctgccgctacttcggtagcttggcgagtgtcgacactttgtgtgctcaattggaatgcggtgagtttaaaacactcagaacctggtgattgatattggcgtaatgcctttatcatttcatcgtatctgaatcttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaatatattaaattttacgacgttgtacgtatagattttgtctcagtataaacgttgtatatcgtactaactaacaccacccaccttattcaacactgtgaacaaatcagagtgtatcaaacatgtctttttttacacgcactgaatgtcccatcatggaatgttgctttgctatccggtaattaattacacgctttaacacacttatatacacgtcgatggagatagttggagtcaacagtactactgggcgagcggtgaaatgcattgaccctttcaagactaccaaaagcgaaagcagttggctaggctatactctttgtggatttgctcagctgtaattgttgtgtaacacacacacccctttgagttgctttgtgcagtgtccgtgtgctgtgttgttgttattattcatgtatgaggtttatgattatattttttgtacgctactcgtggacgatatttgattttgtgagtttgtgtgtgctgcgtaattttattgccacccacaatgcacttcggtgctgcgtgtgtgtgttttatttttaccacgcgcgcgcgaacgtacattctcattcatctaaaacgcccgtgtgtgcatttatatagttatatatcttttgtgtttaatataatacagtacagtactcaccactcacattgcctttgtcgtggaagtgttgttgtggttttgttatgcgcagtgaacatcttttgcaacgcattgattatgtgtgcttgtgtgtaatttattgctatactcacgccaatcgcaagagcggtgtgtgttggctttattttatacacacagcgtacattctcatacatctgacacgcacgcacgcacgcacgcacgcacgcgcattagattagtaattacgcactatacattaccacctctacacgaccacacacatcgaaccactcactcaaacaacaatacactgttgcataggacactttacaacgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccatttttacatcaaacgatgggctctcaattgcacactttaccgtgtgtagttgttatattatattcccaacctgcaacatttttagctgacttgagcttgtgttttcgaacacgctcgtcgctttaaatttattgctaactcaggagttttaatattctctgcacacacattctttacgatagtattaatcaaacgtgtatttttcttcggaattttcactntgttctatcttgattttcggagctttgcgctcaatttatttggtgagatgtaagcacgcgtgattgtataatggtacgttgttgcattcgtgcaacactactcatttttactttcacaatctttgtgtgacgcacgtgttaggcacgggcttactgcagaaatgtttaagacacttctttcctggggtagtatgcatgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgaatttcaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataangtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU total

>Elphidium excavatum | genomic DNA | C62.2 | taxon:212501 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttattataacccgacagtttaaataagtgtttggtaatgatcagtaacttaaactcactcacgtactcaaaaacgaaaatagattactaacgcgatctatatttagtgaaacgcttaccacgttatcacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctaacttttagagacatacacttgacactgtatgtacgccaccgcacaaaattatttacacacaaatgtactccaccacgcatggatgtcttttatgcacgcacgcatatgcgttgtaggcaatttgttgatgtactcgcgctcaattttcaccgcacacaaacgacttatgaccgcaaattatatattagcgaccgcggattttaatcttgccaaaagagctatctttgcaacttgctatagaaccagaccgcactgactgctcgtttgagactttaacgagtctcatatacaagaggttttaaaatgcaactgccaatttgcgcgtcgtacacagtgcgtgtcgcgaggttgattgtcgtgttgggtgtatcttcaaataccgtctataaacgtgtgtgtgtgtgtgtatgtattggatatttgtgcacgcgtgttgtatatacgtccctgtacttattatgtgtgtgtggtgctatgtacgtgtcgtacgtatgctctctaaaaaaacacacacaaaataaatgcttttgacggataactcagggaaagtttggctaatacgtacgaactaaaaaaaaaaactggnttattgtcgtgttgaattgtcgtgtcaaaaagaaccactctctttgtgtttgacattgtgtctacaacgttcctctctcactaacacacacacaccccttattggaataattgcattcactctcgtcgttcacataaaaccaactcacccacactcggttctctgtgtagtaaccgacacacgcgcacattcctcacactttaaaaacaaatatcgcttttcgcgttcagtggttggagtttaccaaacgcaacatgagagacactgaatacgcagtaattaagggacttgcgcccttttttacatacgctgagttgatatgatacgattttctcgtattatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagacggctcttagttctaaggaacgcagcaggcgcgtaaattgtccaataatagtacaatttattcttttaccctaacgaggtaaaattaaaaagtacatgtgaattaaattcgctgtatttttaccacaacacaaaccttaaactaacgtcgagtaaaaaaataatatattgagacagtgacaagctgtaacggttgagtataataattatgacgagtgtctgacttctgccgctacttcggtagcttggcgagtgtcgacactttgtgtgctcaattggaatgcggtgagtttaaaacactcagaacctggtgattgatattggcgtaatgcctttatcatttcatcgtatctgaatcttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaatatattaaattttacgacgttgtacgtatagattttgtctcagtataaacgttgtatatcgtactaactaacaccaccacccaccttattcaacactgtgaacaaatcagagtgtatcaaacatgtctttttttacacgcactgaatgtcccatcatggaatgttgctttgctatccggtaattaattacacgctttaacacacttatatacacgccgatggagatagttggagtcaacagtactactgggcgagcggtgaaatgcattgaccctggcaagactaccaaaagcgaaagcagttggctaggctatactctttgtggatttgctcagctgtaattgttgtgtaacacacacacccctttgagttgctttgtgcagtgtccgtgtgctgtgttgttgttattattcatgtatgaggtttatgattatattttttgtacgctactcgtggacgatatttgattttgtgagtttgtgtgtgctgcgtaattttattgccacccacaatgcacttcggtgctgcgtgtgtgtgttttatttttaccacgcgcgcgcgaacgtacattctcattcatctaaaacgcccgtgtgtgcatttatatagttatatatcttttgtgtttaatataatacagtacagtactcaccactcacattgcctttgtcgtggaagtgttgttgtggttttgttatgcgcagtgaacatcttttgcaacgcattgattatgtgtgcttgtgtgtaatttattgctatactcacgccaatcgcaagagcggtgtgtgttggctttattttatacacacagcgtacattctcatacatctgacacgcacgcacgcacgcacgcacgcacgcgcattagattagtaattacgcactatacattaccacctctacacgaccacacacatcgaaccactcactcaaacaacaatacactgttgcataggacactttacaacgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccatttttacatcaaacgatgggctctcaattgcacactttaccgtgtgtagttgttatattatattcccaacctgcaacatttttagctgacttgagcttgtgttttcgaacacgctcgtcgctttaaatttattgctaactcaggagttttaatattctctgcacacacattctttacgatagtattaatcaaacgtgtatttttcttcggaattttcactttgttctatcttgattttcggagctttgcgctcaatttatttggtgagatgtaagcacgcgtgattgtataatggtacgttgttgcattcgtgcaacactactcgtttttactttcacaatccttgtgtgacgcacgtgttaggcacgggcttactgcagaaatgtttaagacacttctttcctggggtagtatgcatgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgagtttcaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgacaggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataatgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU total

>Elphidium excavatum | genomic DNA | C62.3 | taxon:212501 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttattataacccgacagtttaaataagtgtttggtaatgatcagtaacttaaactcactcacgtactcaaaaacgaaaatagattactaacgcgatctatatttagtgaaacgcttaccacgttatcacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctaacctttagagacatacacttgacactgtatgtacgccaccgcacaaaattatttacacacaaatgtactccaccacgcatggatgtcttttatgcacgcacgcatatgcgttgtaggcaatttgttgatgtactcgcgctcaattttcaccgcacacaaacgacttatgaccgcaaattatatattagcgaccgcggattttaatcttgccaaaagagctatctttgcaacttgctatagaaccagaccgcactgactgctcgtttgagactttaacgagtctcatatacaagaggttttaaaatgcaactgccaatttgcgcgtcgtacacagtgcgtgtcgcgaggttgattgtcgtgttgggtgtatcttcaaataccgtctataaacgtgtgtgtgtgtgtgtatgtattggatatttgtgcacgcgtgttgtatatacgtccctgtacttattatgtgtgtgtggtgctatgtacgtgtcatacgtatgctctctaaaaaaacacacacaaaataaatgcttttgacggataactcagggaaagtttggctaatacgtacgaactaaaaaaaaaaaactggnttattgtcgtgttgaattgtcgtgtcaaaaaganccactctctttgtgtttgacattgtgtctacaacgttcctctctcactaacacacacacaccccttattggaataattgcattcactctcgtcgttcacataaaaccaactcacccacactcggttctctgtgtagtaaccgacacacgcgcacatttctcacactttaaaaacaaatatcgcttttcgcgttcagtggttggagtttaccaaacgcaacatgagagacactgaatacgcagtaattaagggacttgcgcccttttttacatacgctgagttgatatgatacgattttctcgtattatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagacggctcttagttctaaggaacgcagcaggcgcgtaaattgtccaataatagtacaatttattcttttaccctaacgaggtaaaattaaaaagtacatgtgaattaaattcgctgtatttttaccacaacacaaaccttaaactaacgtcgagtaaaaaaataatatattgagacagtgacaagctgtaacggttgagtataataattatgacgagtgtctgacttctgccgctacttcggtagcttggcgagtgtcgacactttgtgtgctcaattggaatgcggtgagtttaaaacactcagaacctggtgattgatattggcgtaatgcctttatcatttcatcgtatctgaatcttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagtggctcgtagttggattgaatatattaaattttacgacgttgtacgtatagattttgtctcagtataaacgttgtatatcgtactaactaacaccaccacccaccttattcaacactgtgaacaaatcagagtgtatcaaacatgtctttttttacacgcactgaatgtcccatcatggaatgttgctttgctatccggtaattaattacacgctttaacacacttatatacacgtcgatggagatagttggagtcaacagtactactgggcgagcggtgaaatgcattgaccctggcaagactaccaaaagcgaaagcagttggctaggctatactctttgtggatttgctcagctataattgttgtgtaacacacacacccctttgagttgctttgtgtagtgtccgtgtgctgtgttgttgttattattcatgtatgaggtttatgattatattttttgtacgctactcgtggacgatatttgattttgtgagtttgtgtgctgggtaattttattgccacccacaatgcgcttcggtgctgcgtgtgtcctttatttttaccacgtgcgcgaacgtgcattctcattcatctaaaacgacgtgtgcatttatatagtcatatcttttgtgtttataatacagtacagtactcatcactcacattgcctttgtcgtggaagtgttgttgtgattttgttatgcgctgtgaacatcttttgcaacgcactatactcacgccaatcgcaagagcggtgtgtgttggstttattttatacacrcagcgtacattctcatacatctgacacgcacgcacgcacgcacgcacgcacgcgcattagattagtaattacgcactatacattaccacctctacacgaccacacacatcgaaccactcactcaaacracaakacactgttgcataggacacwttacaacgaagaacgaaggttgggggatcaaagaggatcagatacsctcgtcgtcccatttttacatcagacgatgggctctcaattgcacactttaccgtgtgtagntgttatattatattcccaacctgcaacatttttagctgacttgagcttgtgttttcgaacacgctcgtcgctttaaatttattgctaactcaggagntttaatattctctgcacacacattctttacgatagtattaatcaaacgtgtatttttcttcggaattttcactttgttctatcttgattttcggagctttgcgctcaatttatttggtgagatgtaagcacgcgtgattgtataatggtacgttgttgcattcgtgcaacactactcatttttactttcacaatctttgtgtgacgcacgtgttaggcacgggcttactgcagaaatgtttaagacacttctttcctggggtagtatgcatgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttatggggcgggttgaattttaatctcttcggggattaattttctcccacctcaaaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcgtcattaattttttgtgcctgtgtttgaccccgcacttcggtgcgcgcgcgtctttcacacacaattactttgacgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcttcggagaatgctgctttataccttcacgggtgtatcgcagtatacggaggcttaatactcagtaactagagggaccgctgttactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgtattactgcgcagcagtatacgcgtgttgtttattgcttcggcaatttactttgcgctatacgccgccttaacctacttcgaaagtatgtgggtaaccaattagaagtagtgatttccctctttataagcacacttatatggagcatcatcacccggcatgccttgtgcatgttttgtgtgtgttgtttgtctacatgtgcttttgtcaattcatagtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttttggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagttggcaggaccgtccaggaaatgcctgcgaataatgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI