Specimen 6009

E. excavatum A220 E. excavatum A220 E. excavatum A220
Species Rotaliida > Elphidiidae > Elphidium > Elphidium excavatum
Isolate number 6009
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on May 2006
Location Wadden sea, Mook Baai, Netherland
Latitude, Longitude 53.0006, 4.78765

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttccgagagtttttgcttcggcaatgctctcttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgttttactaaaggcgtcatatctgttttgtgcgtgtttgacccctcttcggagcgcgtgtcttcacgcacaattactttggcgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgtttgtttttgcaggcagtatatggaggcttttttactcaacaactagagggaccgctgtttctttctttaaaccagaggaaggatacggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgttttactgcgtggcattgcaatccatatttcttcggaagtgtgtttttgttttccgcctcaacctgcttcgaaagcatgcgggtaaccaattagaagtagtgatttccttttttataagcacactaatatggggcatcatcacccggcatgccttgttgtatgttttgtgtgtggtgtttgcttttccatgtgcttttgtcaattcatagtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttatggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagtcggcaggaccgtttaggaaatgttcgcgaataatgtgatct

See sequence on NCBI

Other sequence

SSU total

>Elphidium excavatum | genomic DNA | 6009 | J. Pawlowski 6009 (UniGE) | taxon:212501 | originally identified as Elphidium williamsoni | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttattataacccgacagtttaaataagtgttggtattcagtatacacaccaaacaagtgatacatatcacttatgcaactgcagacagctgcttaatacagtcgcacttgtcttgacttggcacaacccatttacactgtgaccgtttgtcttcgggcagcacacagatgtaaaatgatacacgcacccaaaatgctaaaaaacaaaattaacggataactcagggaaagtttggctaatacgtacgaactatatgatgaattctacacacacacacaccccattcattcatattcacattcagtggttggttttatccatgcgcaacatgagagacactgaacacgcagtatgtgtacgacttcggtctacgcatacatacgctgagttgatatgatacgattttctcgtattatacatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtattattgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacaatgagagacggctcttagttctaaggaacgcagcaggcgcgtaaattgtccagtgatagtacaatttatttttttactactgaatttaccacacgcaaatttaatactgtacgaaaaaaaataatttattgagacagtgacaagctgtaacggttgagtatataaattatgacgagtgtctgacttctgccgctacttcggtagcttggcgagtgtcgacactttgtgtgctcaattggaatgcggtgagtttaaaacactcagaacctggccattggtgtttgcgtaatgctttcatcatttgggtgtatctgaattttcaagtggagggcaagtctggtgcnnnnnnccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaataacttttacgacgttgtaagaaaatctttagaattttctacacacacacacacccactttttcaacactgtgaacaaatcagagtgtatcaaacatgtctttttacacgcactgagtgtccgatcatggaatgttgcttatgtaaatattttgacatgtacactcactctaaaatttttatttacacgtcgatggagatagttggagtcaacagtattactgggcgagcggtgaaatgcattgaccctagtacgactaccaaaagcgaaagcagttggctaggctatactctttgtggatgcatgtttgcgtgactatatgatttgctaagattttacacgcacactgacaaaaaaagcaaatttcattgatcgcacatgcaatacactttacaacgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccatttttacatcaaacgatgggctctcaattgcacacttttccgtgtgtagttgttttattatattcccaacctgcaacatttttagctgacttgagcttacgctcgtcgctttaaattcattgctaactcaggagttaatattttccgcacatactttctatacggtagttattaatgcgatgtattcatgtttttaatgtgtttcttcgttgactactctgattttcggagctttgcgctcaatttatttggtgagatgtaagcacgcgtgattgtattatggtacgtcgttgccttcgggtgacactactcattttttacattcacaaattttgtgtgacgcacgtgttaggcacgggcttactgcagaaatgtttaagacacttctttcctggggtagtatgcatgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggatcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggttccgagagtttttgcttcggcaatgctctcttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgttttactaaaggcgtcatatctgttttgtgcgtgtttgacccctcttcggagcgcgtgtcttcacgcacaattactttggcgtctgaaagcaacgaacgtgaccgtaacctcttgttgccttctcttctcctcggagaatgctgtttgtttttgcaggcagtatatggaggcttttttactcaacaactagagggaccgctgtttctttctttaaaccagaggaaggatacggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgatacattgattacttcagtgagtatctacgttttactgcgtggcattgcaatccatatttcttcggaagtgtgtttttgttttccgcctcaacctgcttcgaaagcatgcgggtaaccaattagaagtagtgatttccttttttataagcacactaatatggggcatcatcacccggcatgccttgttgtatgttttgtgtgtggtgtttgcttttccatgtgcttttgtcaattcatagtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgagtttatggttcaacaaaccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatattatgagtcggcaggaccgtttaggaaatgttcgcgaataatgtgatct

See sequence on NCBI