Specimen C131

H. orbiculare C130 H. orbiculare C130
Species Rotaliida > Incertae sedis > Haynesina > Haynesina orbiculare
Isolate number C131
Collector Loic Pillet
Identifier Loic Pillet
Collected on July 2008
Habitat salt marsh
Depth 0
Location Canada, Chezzetcook Inlet
Latitude, Longitude 44.7045, -63.2545

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacatacacaatgtgagtgtgagtgagtgtatttatacacacaccgacactacgcatgtgataaacatgattggctctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcaaataagaatcacattatattgtgtgtgtgagtgtgtatttatttacacgcacgcgcgcataacatgtattttgtgatatctatgaaagcaacgaacgtgaccgcaacctctagttatgataagcatggtatcataacactagagggaccgctgctactttcaactttaaccaggggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatcattgcagtgcgtatcttcaaattattacactgcttgtgctggcacacgtgcttgcacgcagtatgcattgcctacttcgaaagtcgtgggtaatcaatttgaagtaatgatatattccttatgcacatttatatacggtgcatgcatatgacacatgaacgcgctcgcgtgtgattgtattgtgtgcataatctgtatgtgcaattgtcaattcatggtggggacagagtattgttaattgttgctctcggttttaactaggaatgccttgtacgggttggtttaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtaatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgccgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacatacacaatgtgagtgtgagtgagtgtatttatacacacaccgacactacgcatgcgataaacatgattggctctttcatgattatgtgataggtggtgcatggccgttcctagttcgtggagtgatttgtctgcttaattgcgtttcaaataagaatcacattatattgtgtgtgtgagtgtgtatttatttacacgcacgcgcgcataacatgtattttgtgatatctatgaaagcaacgaacgtgaccgcaacctctagttatgataagcatggtatcataacactagagggaccgctgctactttcaactttaaccaggggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatcattgcagtgcgtatcttcaaattattacactgcttgtgctggcacacgtgcttgcacgcagtatgcattgcctacttcgaaagtcgtgggtaatcaatttgaagtaatgatatattccttatgcacatttatatacggtgcatgcatatgacacatgaacgcgctcgcgtgtgattgtattatgtgcactatctgtatgtgcaattgtcaattcatggtggggacagagtattgttaattgttgctctcggttttaactaggaatgccttgtacgggttggtttaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtaatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgccgatggatcatta

See sequence on NCBI

Other sequences

SSU total

>Haynesina orbiculare | genomic DNA | C131.1 | taxon:933849 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatttataacccgacagtttaaataagtgtacattttatgatatgcattagatttttataaatcatgtgcatatatgatgagggatcacagtgatgacttaaggaaccatcacttatgcaactgcagacagctgtttaatacagtcacacttgtcttgacttggcaatatatatgcgtgtgggtgtgggcacaggcacactcacacgcctttctctgttatctatacacattcagataactgcatggataactcagggaaagtttggctaatacgtacgggtacgatgcttacatgacacatatacaggaaagagaagcacacgtgagctgggcactcacaatgacacatacatacatgcactcacacgtgagctgggcactcacgcgagagctgtcacacacacactacacatttactactctcacacgtgagactatgtgaacaactaagttctgtgcagtaaggcggggtagacctcgtgagctagtaaaccgcggtcagtcaccatcatagcatcacgccgagagctgtatctgtgttatgtgtatgtgagagcactcacacgtgggctgngcactcacgcgagagtgtgtgctgtgtattgtattggtatatgctgtgggcactgaatatctccgggtattcgatgcacacattacaggcggatatagcatatactatatacattacacatagcacatgcactcacacgtgagggctagctgtgtttgtgtcattattatacacagtgagagagctgtgctgtgtatatagcacatgctgtgtgctgtgcgtgagaactgaatttattcgggtcacacacatagcacacactacaggcggacatagcatgtattatatatacgcacacgctctcacactattactcagcgctcaatggtgatacattatacgtacgaacgcaacatgagggacattgagcacgcatttcattatgtgcgtgatcctcgggtcacacacattaatgattcgcatatgctgagcagactttgctatacgcgaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctatatttaaccgtatgggcgaaagtattgcgtgcatatttacattacgcacattaggtttatattaaatccatgtgtgtattatgagatgttacactatgtttaaattactgtcacatatattgcccatccttgttcactcgttgaacgaaatatgctcgcatattttattcgctcagttacattttaaactgaggcagtgacaagctgtaacggttgagtatttaaaatgacaagtgtctggcattgccgctctctcgggagcttggcaaattgccgacgctttgtgtgctcaattggaatgcggtgagtataagccactcagaacccattgattttgtgctgacatgagcagtgcattttcaattgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaacaccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaacattatacacacacacactgtgaacaaatcagagtgtatcaaacatgtactttcttagaatgtgcactgaatgtcttatcatgggatgttgcctacatattctaagtgcagacgagatacactgtttggttaatattcatatatacacacactacaattaacatctcacgctatgcaagttaaataatatatgtcgatggkgatagttggagtcaacagtattgcagggcgagcggtgaaatgcgttgacccttgtaagactaccagaagcgaaagcggttggctaggctatgctctttgtgatttatgatgtgacgcacgctttaggcacgcgcttactgcagaaatgtctgagacattvscctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacatacacaatgtgagtgtgagtgagtgtatttatacacacaccgacactacgcatgtgataaacatgattggctctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcaaataagaatcacattatattgtgtgtgtgagtgtgtatttatttacacgcacgcgcgcataacatgtattttgtgatatctatgaaagcaacgaacgtgaccgcaacctctagttatgataagcatggtatcataacactagagggaccgctgctactttcaactttaaccaggggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatcattgcagtgcgtatcttcaaattattacactgcttgtgctggcacacgtgcttgcacgcagtatgcattgcctacttcgaaagtcgtgggtaatcaatttgaagtaatgatatattccttatgcacatttatatacggtgcatgcatatgacacatgaacgcgctcgcgtgtgattgtattgtgtgcataatctgtatgtgcaattgtcaattcatggtggggacagagtattgttaattgttgctctcggttttaactaggaatgccttgtacgggttggtttaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtaatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgccgatggatcatta

See sequence on NCBI

SSU total

>Haynesina orbiculare | genomic DNA | C131.2 | taxon:933849 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatttataacccgacagtttaaataagtgtacattttatgatatgcattagatttttataaatcatgtgcatatatgatgagggatcacagtgatgacttgaagcaccatcacttatgcaactgcagacagctgtttaatacagtcacacttgtcttgacttggcaatatatatatgcgtgtgggtgtgagcacaggcacaccacacacgctcatttctctgttatctatacacacgtcgttcgcgataactgcatggataactcagggaaaatttggctaatacgtacgggtacgatgcatatatgacacattatacaggaaagagaagcacacgtgagctgggcactcacaatgacacatacatacatgcactcacacgtgagctgggcactcacgcgagagctgtcacacacacactacacatttactactctcacacgtgagactatgtgctgtgcagtaagccggggtaccaaagcggatcacatgctgtaagtcacagagctgattacatagtaacacgagagctgtatctgtgttatgtgtatgtgagagcactcacacgtgggctgggcactcacgcgagagtgtgtgctgtgtattgtattggtatatgctgtgggcactgaatatctccgggtattcgatgcacacattacaggcggatatagcatatactatatacattacacatagcacatgcactcacacgtgagagctagctgtgtttgtgtcattattatacacagtgagagagctgtgctgtgtatttagcacatgctgtgtgctgtgcgtgagaactgaatttattcgggtcacacacatagcacacactacaggcggatatagcatgtattatatacacgcacacgctctcacactatactcagcgctcaatggtgatacattatacgtacgaacgcaacatgagggacattgagcacgcatttcattatgtgtgtgatcctcgggtcacacacattaatgattcgcatatgctgagcagactttgctatacgcgaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctatatttaaccgtatgggcgaaggtattgcgtgcatatttacattacgcacatagattttatattaaatccatgtgtgtattatgagatgttacactatgtttaaattactgtcacatatattgcccatccttgttcactcgttggacgaaatatgctcgcatattttattcgctcagttacattttaaactgaggcagtgacaagctgtaacggttgagtatttaaaatgacaagtgtctggcattgccgctctctcgggagcttggcaaattgccgacgctttgtgtgctcaattggaatgcggtgagtataagccactcagaacccattgatattgtgctgacatgagcagtgcattttcaattgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaacaccagctccactggcctatacaatcattgttgcggctaagaggctcgtagttggattgaactaacatttatacacacacacactgtgaacaaatcagagtgtatcaaacatgtactttcttagaatgtgcactgaatgtcttatcatgggatgttgcctacacgttctaattgccgacgagatacactgtttggttaatattcatatatacacacactacaattaacatctcacgctatgcaagttaattaatatatgtcgatggggatagttggagtcaacagtattgcagggcgagcggtgaaatgcgttgacccttgtaagactaccagaagcgaaagcggttggctaggctatgctctttgtgagttatgatgtgacgcacgctttaggcacgcgcttactgcagaaatgtctgagacatnscctccgggggtagtatgcacgcaagtgtgaaactkgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacatacacaatgtgagtgtgagtgagtgtatttatacacacaccgacactacgcatgcgataaacatgattggctctttcatgattatgtgataggtggtgcatggccgttcctagttcgtggagtgatttgtctgcttaattgcgtttcaaataagaatcacattatattgtgtgtgtgagtgtgtatttatttacacgcacgcgcgcataacatgtattttgtgatatctatgaaagcaacgaacgtgaccgcaacctctagttatgataagcatggtatcataacactagagggaccgctgctactttcaactttaaccaggggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatcattgcagtgcgtatcttcaaattattacactgcttgtgctggcacacgtgcttgcacgcagtatgcattgcctacttcgaaagtcgtgggtaatcaatttgaagtaatgatatattccttatgcacatttatatacggtgcatgcatatgacacatgaacgcgctcgcgtgtgattgtattatgtgcactatctgtatgtgcaattgtcaattcatggtggggacagagtattgttaattgttgctctcggttttaactaggaatgccttgtacgggttggtttaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtaatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgccgatggatcatta

See sequence on NCBI