Specimen 6008

Species Rotaliida > Incertae sedis > Haynesina > Haynesina germanica
Isolate number 6008
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on May 2006
Location Wadden sea, Mook Baai, Netherland
Latitude, Longitude 53.0006, 4.78765

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaatacacacactacggtgtgtgcatgaaatatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcacatacacataatattgatgcgttgtgtgtataatttataattatacgcatacacacatattatattgtgctttgaaagcaacgaacgtgaccgcaacctcttgttgcctgtatatatgtgtattttatacacaccacaggctattataaactagagggaccgctgttactttcttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatcattgcagtgcgcatctcattttgttatacactgcttgtgcgtatgtgcaccatatatttatatgtgtgtgtatgtattgcacgcagtaaagcctacttcgaaagttgtgggtaatcaatttgaagtaatgatttctccaaatatatactgcacactcatatgcagtatcttatgtccatgaaaatattttattatttttgtgtgtgcattcgatgcttgtatgtgcaattgtcaattcatggcggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggattttatatctatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaac

See sequence on NCBI

Other sequence

SSU total

>Haynesina germanica | genomic DNA | 6008 | J. Pawlowski 6008 (UniGE) | taxon:45993 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttattataacccgacagtttaaataagtgttgaattgatatcatcatacacaatacagtgatttatacgcaatcacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcaataccaacctacacatacacacacaatttctctgttatctcatatttgataactcgcttatggataactcagggaaagtttggctaatacgtacgagagagtagatcacaatgacacacacatacacactcacacttttactcagcactcaatggtaaaatatttatacattttacacgcaacatgagagacattgagcacgcttttatgtgcaatatgtgatttcggtcacatatacgcatataatacacacagctgagcagactttgcacttacgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcacagtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctattttatagcgaaaatattggcgcatatttacttacacatgatacaatgatacactgataataaactgtcacattataatacacacacacacacatatccttgttcacactcgcgtaaatatgcattcaatgtatatatattactgaggcagtgacaagctgtaacggttgagtataattaatgacaagtgtctggcattgccgctctctcgagagcttggcaaattgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaattttgtgcttcacatatcatgtgttgcactattcacgtatctgaatttcaagtggagggcaagtctggtgcnnnnnnccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatacacacacatatatttagcaagcgtatattctatatgcgtttcgactaatattttataatctgcattggaactcacacatacacactgaatgctgtggttgcatgtaattataatatatatgtgtatttttgtctcacaacactgtgaacaaatcagagtgtatcaaacatgtactttcttagaatgtgcactgaatgtcttatcatgggatgttgcctcatattctaaccacagagagtttacatatgatatacacactcacacatacacacaattatattatataattattgacacacaccacacattattctctctgcggttattcaaatgtcgatggggatagttggagtcaacagtactgctgggcgagcggtgaaatgcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctattctctttgtgattatctcataacatacacatgtgtgtacacacatacacactcactcacacactgtgtatatatgtgagattctaacacattacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttttacatcaaacgatgggctctcaattgcatttcactttttatcaagtgtcttgtagtttacatcctcaacctacaaactattctaatagcttgagcttgtgtcattctatgatacgctcgctgtctgaatttatttatgtacggtctcgacggacgtttacaggtcatttttataatacctatttttgcgtgtaagcatagctgaattctaaattcacatgcgtgcacttgattttcggagctttgcgctcaatatataatctggtgagatgtaagcatcatgtatctatataaccacactcacggtttcggctgcgcagtgtgtgttaatattcatacaactacaatttatgatgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtttgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaatacacacactacggtgtgtgcatgaaatatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcacatacacataatattgatgcgttgtgtgtataatttataattatacgcatacacacatattatattgtgctttgaaagcaacgaacgtgaccgcaacctcttgttgcctgtatatatgtgtattttatacacaccacaggctattataaactagagggaccgctgttactttcttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatcattgcagtgcgcatctcattttgttatacactgcttgtgcgtatgtgcaccatatatttatatgtgtgtgtatgtattgcacgcagtaaagcctacttcgaaagttgtgggtaatcaatttgaagtaatgatttctccaaatatatactgcacactcatatgcagtatcttatgtccatgaaaatattttattatttttgtgtgtgcattcgatgcttgtatgtgcaattgtcaattcatggcggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggattttatatctatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaac

See sequence on NCBI