Specimen D3

E. aculeatum D3 E. aculeatum D3
Species Rotaliida > Elphidiidae > Elphidium > Elphidium aculeatum
Isolate number D3
Collector Jan Pawlowski
Identifier Loic Pillet
Collected on September 2008
Location Mediterranean Sea, Porquerolles, France
Latitude, Longitude 43.0012, 6.20422

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaaaaggtatgtttgtgtctagtatgctataatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattggaagtaacgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Other sequences

SSU total

>Elphidium aculeatum | genomic DNA | D3.1 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagcatgcaagtggttattttttaataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttaactaatttacgaacaacggataactcagggaaagtttggctaatacgtacgaacaattattattgcatacagttacgcatgaatgagattgtatacgtgcgcgtgcttgcaccgcacacggcagatattgtgtatttataacacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtagttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatcatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgttatcatatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatttttatatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtataccatcattatacaatacacatacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU total

>Elphidium aculeatum | genomic DNA | D3.2 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttattttttaataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttaactaaatttacgaacaacggataactcagggaaagtttggctaatacgtacgaacaattattattgcatacagttacgcatgaatgagattgtatacgtgcgcgtgcttgcaccgcacacggcagatattgtgtatttataacacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgttatcatatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatttttatatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagcaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtataccatcattatacaatacacatacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU total

>Elphidium aculeatum | genomic DNA | D3.3 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggctattttttaataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagagagctgcttaatacagtcacacttgtcttgactcggtttaactaatttacgaacaacggataactcagggaaagtttggctaatacgtacgaacaattattattgcatacagttacgcatgaatgagattgtatacgtgcgcgtgcttgcaccgcacacggcagatattgtgtatttataacacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatcatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgttatcatatacgtgtatctgaatgttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatttttatatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtataccatcattatacaatacacatacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaaaaggtatgtttgtgtctagtatgctataatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattggaagtaacgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI