Specimen A13

E. margaritaceum A13 E. margaritaceum A13 E. margaritaceum A13
Species Rotaliida > Elphidiidae > Elphidium > Elphidium margaritaceum
Isolate number A13
Collector Loic Pillet
Identifier Loic Pillet
Collected on August 2007
Habitat Macro algae
Depth 0
Location English Channel, Trebeurden, France
Latitude, Longitude 48.7878, -3.5823

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacaatttatattgttacaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatatttaaatatgtatacgtatgacccaataactatgttgttgtgtgtctagtattactatcatttgaaagcaacgaacgtgaccgtatccttttattatatacacacatgtatatctttttaaagggaccgctgttttctttcttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgatcatttcattaagtatcttgtgtatgtctcatacgatcctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaaccatgtaccgttatattacatcccatatacttacgtgtatgcgtgtgtgttttattattcgtttgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtactctgtgtacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta See sequence on NCBI

See sequence on NCBI

Other sequence

SSU total

>Elphidium margaritaceum | genomic DNA | A13 | taxon:933848 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatyttwaaaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggttactactactacgctcttacggataactcagggaaagtttggctaatacgtacgaacaaattctatattcgcatacagttacgcatgaatgagattgtatacgtgcgcatgtttattcatcgcacacggcagatattgtaattttattacgatacatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacatacggtataattacttcacctcattctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctatgtttcattacatgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacaaccaattgttacaatactgtgatcaaatcagcacgtatcacgtatgcatttttaatatgcattgtatgtttattcatggaatgttgtatttttatatgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttatacattacactctgtattcacactctttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaacaaaatatatttatacgttttacgtattttatattattttactgattttctaagctttgcgctcaatttatatacggtgagatgtaagtaatggctgcgtattttattacgtgtgctaaattatgatgcacgcattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacaatttatattgttacaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatatttaaatatgtatacgtatgacccaataactatgttgttgtgtgtctagtattactatcatttgaaagcaacgaacgtgaccgtatccttttattatatacacacatgtatatctttttaaagggaccgctgttttctttcttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgatcatttcattaagtatcttgtgtatgtctcatacgatcctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaaccatgtaccgttatattacatcccatatacttacgtgtatgcgtgtgtgttttattattcgtttgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtactctgtgtacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI