Specimen A108

E. margaritaceum A108 E. margaritaceum A108 E. margaritaceum A108
Species Rotaliida > Elphidiidae > Elphidium > Elphidium margaritaceum
Isolate number A108
Collector Loic Pillet
Identifier Loic Pillet
Collected on August 2007
Habitat Macro algae
Depth 0
Location English Channel, Roscoff, France
Latitude, Longitude 48.7273, -3.99092

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacaactattgttgttacaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatatttaaatacgtatacgtatgacccaatacattgtatcgcgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattaatatactacacacgtatatattcattattaaagggaccgctgtttctttcttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctcgtatatatgtgcatatagctcttatataaatcctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaaccatgtaccgttatattacatcccacacatattatttatgcgtgcgtgtgtgttttattattgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtacgcatgtacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacaactattagttgtgtacaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatatttaaatacgtatacgtatgacccaatacattgtattgtgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattaatatactacacacgtatatattcattattaaagggaccgctgtttctttcttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctcgtatatatgtgcatatagctcttatataaatcctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaaccatgtaccgttatattacatcccacacatattatttatgcgtgcgtgtgtgttttataaattgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtacgcatgtacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Other sequences

SSU total

>Elphidium margaritaceum | genomic DNA | A108.1 | taxon:933848 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttaatatattaaccctatcagtttaaacatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttatattatcatacggcgctctacggataactcagggaaagtttggctaatacgtacgaacaacttctattgtcgcatacagttacgcatgaatgagattgtatacgtgcgcatgaatttatattcatcgcacaaggcagatattgtaatttattacgatacatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgagccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcagacgcgtaaattgcccaataatagtacatacggtatattcactctcattctattgaggcagcgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgacactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctatatttgatttatgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacaaccaatatacacaatactgtgatcaaatcagcacgtatcacgtatgtaatattatacgcattgtatgtttattcatggaatgttgtatttttatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttatacagtactacacgtacacgtacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaacaaaaatatattcgtatattcgtatacgttatatatcatattcgattttccaagctttgcgctcaatttatatacggtgagatgtaagtaatggctgcgtatttattacgtatgctatattatgatgcacgcattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaggtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacaactattgttgttacaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatatttaaatacgtatacgtatgacccaatacattgtatcgcgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattaatatactacacacgtatatattcattattaaagggaccgctgtttctttcttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctcgtatatatgtgcatatagctcttatataaatcctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaaccatgtaccgttatattacatcccacacatattatttatgcgtgcgtgtgtgttttattattgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtacgcatgtacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU total

>Elphidium margaritaceum | genomic DNA | A108.2 | taxon:933848 | SSU | SSU | small subunit ribosomal RNA aaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttatattttcgatcatacggcgctcaacggataactcagggaaagtttggctaatacgtacgaacacacttctattgtcgcatacagttacgcatgaatgagattgtatacgtgcgcatgaatttattcatcgcacaaggcagatattgtaatttattacgatacatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacatacggtatattcactctcattctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctatattaatttatgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggmctatacaatcattgttgcggttaagaggctcgtagttggattgaacaaccactatacacaatactgtgatcaaatcagcacgtatcacgtatgtattttttaatacgcattgtatgtttattcatggaatgttgtatttttatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttatacagtactacacgtacacgtatacacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaacaaaaatatattcgtatattcgtatacgttatatatcatattcgattttctaagctttgcgctcaatttatatacggtgagatgtaagtaatggctgcgtatttattacgtatgctatattatgatgcacgcattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacaactattagttgtgtacaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatatttaaatacgtatacgtatgacccaatacattgtattgtgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattaatatactacacacgtatatattcattattaaagggaccgctgtttctttcttttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctcgtatatatgtgcatatagctcttatataaatcctaccctgagaatgggcgggtaatcaattagaagtaatgatttccttttttttatacgcaaccatgtaccgttatattacatcccacacatattatttatgcgtgcgtgtgtgttttataaattgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtacgcatgtacggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI