Specimen 343

Species "monothalamids" > Clade F > Notodendrodes > Notodendrodes hyalinosphaira
Isolate number 343
Collector Sam Bowser
Identifier Sam Bowser
Collected on December 1996
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Notodendrodes hyalinosphaira | genomic DNA | 343 | taxon:159871 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA gggaaatcttaccgggtccggacacactgaggattgacaggtgtttcgttttcatatggtattgtatcaatgcgtttttcctttttggagaaatgtacatatgtactattatgcaaaacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatggctcgtacgtgttttatgctaatactgtgacctcattgttcttttacagagtggtgactgcgtccggtatggtatacgctgcgatcgccacgaaggcaacga

See sequence on NCBI