Specimen 1225

Species "monothalamids" > Clade F > Notodendrodes > Notodendrodes hyalinosphaira
Isolate number 1225
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Notodendrodes hyalinosphaira | genomic DNA | 1225 | taxon:159871 | 19 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtgtttcgttttcatatggtattgtatcaatgcgtttttcctttttggagaaatgtacatatgtactattatgcaaaacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatggctcgtacgtgttttatgctaatactgtgacctcattgttcttttacagagtggtgactgcgtccggtatggtatacgctgcgatcgccacgaaggcaacgaacgtgaccgcagcctcttgttgcctcccatgtgcaaactgcattgtatttctgcgtgttgtactttagggtataatatgtgttatgctttcggtttttgccacagttttttcacttgtattcatttcgtatatctttggtgatttgcgaagactacttggatttatatttgtgttatgtggtcgcttcaaatgcggctatgtacacttttgtattttccttgtatgtctctctgttgcttttgagatatatttgtttatgtgtacatcgaaattatctgcagtggagggaaactagagggaccgctgactctttataaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctacccagttcgtgtgcacagtttttcgttacattaatactttaaagggtatatattatgcatgtgttggtggcgtctttcgctagatgccctgatatgtgtgtgtgttgcctgttagtgttagcgggctgatgcatttttacgactaggctacttcgaaagtaagtagctaatcaattcgaagtaatgatttcctttgcatattttatatatgtcctgtattttatgggtgttttctcttttcagagtttacgtctccgtattattcagtggcatgtgctccattaattcgtggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacagaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaaactccttttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI