Specimen 340

Species "monothalamids" > Clade F > Notodendrodes > Notodendrodes antarctikos
Isolate number 340
Collector Sam Bowser
Identifier Sam Bowser
Collected on December 1996
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Notodendrodes antarctikos | genomic DNA | 340 | taxon:162490 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA gggaaatcttaccgggtccggacacactgaggattgacaggtgtttcgttttgatgcagtacttatatcaatgctttttgttgctttggcagcggtttaattatcgttgtttttgtagtggggagtacatatgtgccgtattacaaaacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactatggcacgcatgtgttttatactaatactgtgacctcattgtttttttacaaagcagtgactgcgtccggtatggtatgcgctgtgatgcctcgaaggcaacga

See sequence on NCBI