Specimen 1082

Species "monothalamids" > Clade F > Notodendrodes > Notodendrodes antarctikos
Isolate number 1082
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Notodendrodes antarctikos | genomic DNA | 1082 | taxon:162490 | 6 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtgtttcgttttgatgcagtacttatatcaatgctttttgttgctttggcagcggtttaattatcgttgtttttgtagtggggagtacatatgtgccgtattacaaaacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactatggcacgcatgtgttttatactaatactgtgacctcattgtttttttacaaagcagtgactgcgtccggtatggtatgcgctgtgatgcctcgaaggcaacgaacgtgaccgcagcctcttgttgcctcccttgtgcatgctgcattgtgttttgtggtagtgttttcatttttaatgaattcgccatgttacgctttcagttttgccacagttttttcaactgtatgtattatcttatgcctgtntggtgttttagagttgcactatgcgtatgtggttgctacaaatggtgatcgtgtgcgtttgtgtgacatcttggcgctgcttttagggtatattgcatgtgcgtacaaagaatttatctgcagtggagggaaactagagggaccgctgactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatcttacccagttcgtgtgcacagtttcagttacactgatactttaaagggtattggttgtgtgttgaaggttttgcctttatacgcatggcttttacctgttggtgttagctggctgatgcatttttacgactaggctacttcgaaagtaagtagctaatcaattcgaagtaatgatttcctttgcatatnttatatatgtcctgtattttaaggctgttttctcttttagagattacaatttacctctattatacggtggcatgtgctccattaattcgtggtggggacagaccattgttaattgttggtctcgttttcaactaggagtgccttgtacgggtctttggttcaacagaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttcactgtgagtttgagggactggaaaccctttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI