Specimen 5410

Species Rotaliida > Incertae sedis > Oridorsalis > Oridorsalis umbonatus
Isolate number 5410
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 2005
Depth 2462.4m
Location Arctic Ocean, AWI Hausgarten
Latitude, Longitude 79.3, 4.1

Barcode sequence

SSU partial


See sequence on NCBI

Other sequence

SSU total

>Oridorsalis umbonatus | genomic DNA | 5410 | J. Pawlowski 5410 (UniGE) | taxon:331062 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacattaaacttactccatcacgcacaacacatgattttgtttacagtagtaacaatttcagcgtgagtcacctcagcagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtcaataaaaaatttcattcgacacctgttcgcgcaggcagacggtggatttttttattttgttgcatcacgcatacaaaatttttttgatttctctgtatcgcttattctcaaaggacatgcgttacaccgtgacaattttcttttatggataactcagggaaagtttggctaatacgtacgagtaatctacctcacacacacacacactcacgcacacaattcaaaaattattttgttttgccgtgtrtcgactatacatttcactactcagcactcaatggtaaaactttggccgcgttcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgttcctttgggaacttcacatcgcgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtattttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacataacaagtttatcacacacacatataacactatattttttctgttacccatacagaattttctattctggacatccttgttcgttgttttattcagcataaataatatatctccaattttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgcttygtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttcgtgtatctgaatttcaagtggagggcaagtctggtgcnnnnnnnngcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaatatgaatgaattctcatcattcagtttgaaagttttacgcgttggaatcaaatttatttgatttctcagcgcgttcgacgctgttaaaatttttacaatttacactgtattaattttttttaccaacggcacaaattttttctgccgcatatatttttactcacacacactcataacccacacaatatatgcatcacacgcgggaaatctttggaactcattcactcatagaatttattctcctttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcgccttaaaaaaattttactgcattacgtgccgtacatatttttttatacacacacacgcatacgcacatgtttacatagccacgtaaaaatttttatcaacggtaatttttttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattataatgtattcgcgctatttcttcacacacacacgcaaaaagttttagcgcacacagtacatattatatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcagcttacaaaataacttggcttgagctcgtatttttatacgctcgcctaatttttttcgtatagtctcgatggacgtttcatttattattttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcattgtgtcatactgcccgcagcgtatagtctcggctatttcgtctgtcgtgtgtagttgacaatcttgatgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgtttcggcgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagaatctatcaatacgtgcgttgcggcactttgacccctctctgagcgcgcgtcttagttgcttagctcgcacaattaggttctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatttttgctgttctcagcattaatgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttttacacaccgcatgcgcgagtccgtttattcacttcggtgttttaaacgtgtatttctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaacgatttcctttagcacacatatatacggcgtctatgcccgggttgccttgttgtaacttctgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactgggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggggatcgcggacgatttatctgcacaacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI