Specimen 510

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis planatus
Isolate number 510
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 1997
Habitat Reef sediment
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

>Peneroplis planatus | genomic DNA | 510 | marine sediment sample | taxon:128053 | 4 | Australia:Lizard Island | Sep-1997 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagattattatatatttatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatgcattatatagtaatatataatttaatattgtgctgccttatatttatatataaggattttaagtgaacatattaatattgttttgctatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataattaatgttaattcattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctatatcaactacacttaataagtgttaataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattatggtatatctatattatgtatatagtattttactattacataaataccattaactaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacatacgtactatcagtacattgaaactcatacttacatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI