Specimen 5149

Species Rotaliida > Incertae sedis > Oridorsalis > Oridorsalis umbonatus
Isolate number 5149
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on February 2005
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Oridorsalis umbonatus | genomic DNA | 5149 | seawater, depth:2167m | taxon:331062 | Antarctica:Weddell Sea | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgtttcggcgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaggatctatcaatacgtgtgttgcggcactttgacccctctctgagcgcgcgtcttagttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatttttgctgttctcagcattaatgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttttacacaccgcatgcgcgagtccgtttattcgcttcggtgttttaaacgtgtatttctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaacgatttcctttagcacacatatatacggcgtctatgcccgggttgccttgttgtaacttctgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggatcgcagatttatctgcacaacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI