Specimen 2632

Species Robertinida > Robertinidae > Robertina > Robertina arctica
Isolate number 2632
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 2001
Location Svalbard

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaaaatggagtctcgcatttatttgcgtgttcttctttttatgtcaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgnggagtgatctgtctgcttaattgcgtttcactaagagttctaaacttaatgtgtattgcagcggtttcattgacccctgtcaatttattggcggtgttgttgtctttgtttcttgtctgcttacactactgagctctgaaagcaacgaacgtgaccgcagcctcttgttgcctttcgtaaaacaatcgcttttcattaagcttttgatcaaaaaaggctcattttttaaactagagggaccgctgtatcttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttgatacatcgcttgcgcgagtcacactgtttattcagtgttgttctttgcgcgcgataaagcctgcttcgaaagttagtgggtaatcaattagaagtaatgatttcctaattcttcgcacaataatatactgcattcattaccgaccttgccttgtgtttggttctgagttacatgagtgttgaggctctctgagttctctttcagtatgtgcaaatgtcaactcccggtggggacaaaccattgttaattgttggtttcggtctcaactaggaatgccttgtactggtctttggttcaacaaaccaccaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaattgtttgtctacattcacttgtattcaaatcctctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Robertina arctica | genomic DNA | taxon:551669 | 18S ribosomal RNA rbrtnactcaaagattaagccatgcaagtggttataataacccgatagtttaaataagtgttataaattttgagaatcgcttcaaaaattgtactttaaacacacctcttttgacgattcagagcaaaatttcggatgataacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgactttggcactcgatcaaatcatctttgattcatacactcactgggccagaactaacacttacagtcacctgtttttgtcttctgggttccctttattgaattatcgatgtttttgtttgatacgacaaaaagatttctctgtagcggttcttatattttttacgaaatatttcgacgttacatcgtgcattttacttttcggataactcagggaaagtttggctaatacgtacgagcatctttaatcttacacacccacaccactctctgcacaacgagaaaagatcttttactcagcacttattggtaaatgtttgatgcgctttcgagtgcatctttcaacatttaaaagcaacatgagagacaataagtacgcaggattgggcatttcttgtcctttccatacgctgagcagactttgcgaagttcacttttgcgaagcaagtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgatagtaccctacaatatgtaataccatcattcacaaaattttttaacacacaattttctctgtcaactttaatccttgtcagactgaatcaattaattaaccttgtgaattcattttctcatattattttactgaggcagtgacaagctgtaacggttgagtataataatgacgagtgtctgacattgccgcctgcttctgtaggcttggcagtctgtcgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttgtaaaaagcattgttcttgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaactttaaaaacacaatttcaggtttcttcggatctcgttctgatgtaatacgcacacgtacccacgtcagcaacgttctttgcggattcttgtttttgatttttatttaccaaagtttgtagcacaagacactttgtctttttctagatgaagtgtgcttgtacgacgctgttaattgtattcggtcttgaatgacaaatatgatttgcagtctgatacacaaacgaaataaagatcttaccatttttatcgttttcaacactgtgaacaaatcagagtgtatcaaacatgtcttttctaaatgtgcattgaatgttccatcatgggatgctgcacttttaacactttcttttcccatgttttgctaaccactcacactgtagctttacaaccgggtaaaacatgtgaaggcatgtgctatacttcatactgtcttttgaaaagaaaacagttataaatgtcgatggggatagttggagtcaagagtactgttgggcgagcggtgaaatgcattgaccctagcaagactaccaaaagcgaaagcacttgactaggctatactctttgtgatgtcagtgtttgaagatacacgctactcgcgtatcatggttatttgcggagcaattaacgttagttgcgtattgccaactttcgagagattgttagagtgaacggcaacggatactgttgttgttatcgcatttattcattgatcgcaatttgcacttcattcatctggttacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttttaaatattaattgcaaatgccctcaacctacaaaatattgaatattttcgttgcttgagctagtgtctttattgatacgctcgctttgaatttatttgttttcgtacggtctcgatggacgtttcgattaaaaaatctaattttttgcgtgtatgcattttgactttatcttcattgataattcattgcgtgcacttgattttcggagctttgcgctcaaattttggtgagatgtaagcactgtgtcattctacacgagaactttccgttcaatttattgttcggacttgcttcatcgtttgtagtctgatattttttcaaataggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaaaatggagtctcgcatttatttgcgtgttcttctttttatgtcaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgnggagtgatctgtctgcttaattgcgtttcactaagagttctaaacttaatgtgtattgcagcggtttcattgacccctgtcaatttattggcggtgttgttgtctttgtttcttgtctgcttacactactgagctctgaaagcaacgaacgtgaccgcagcctcttgttgcctttcgtaaaacaatcgcttttcattaagcttttgatcaaaaaaggctcattttttaaactagagggaccgctgtatcttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttgatacatcgcttgcgcgagtcacactgtttattcagtgttgttctttgcgcgcgataaagcctgcttcgaaagttagtgggtaatcaattagaagtaatgatttcctaattcttcgcacaataatatactgcattcattaccgaccttgccttgtgtttggttctgagttacatgagtgttgaggctctctgagttctctttcagtatgtgcaaatgtcaactcccggtggggacaaaccattgttaattgttggtttcggtctcaactaggaatgccttgtactggtctttggttcaacaaaccaccaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaattgtttgtctacattcacttgtattcaaatcctctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI