Specimen 3974

Species "monothalamids" > Clade BM > Micrometula > Micrometula hyalostriata
Isolate number 3974
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on June 2003
Habitat soft sediment
Depth 60m
Location Scotland, Creag`s Hole
Latitude, Longitude 56.28, -5.3

Barcode sequence

SSU partial

>Micrometula hyalostriata | genomic DNA | 3974 | taxon:1051367 | 1 | United Kingdom:Dunstaffnage | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgaaagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttgctcttacgggagttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtggaaaattttattttcctacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggcttgttttaaagctttcgggtggagaagcaggttcttttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcantttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcgaacagggtggtctaaaggaaagagaagtcgtaacaaggccatcggtaggtgaacctgcagaaggatca

See sequence on NCBI