Specimen 6833

Species "monothalamids" > Clade BM > Micrometula > Micrometula hyalostriata
Isolate number 6833
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2003
Habitat soft sediment
Depth 148m
Location Norway, Bergen
Latitude, Longitude 60.18, 5.14

Barcode sequence

SSU partial

>Micrometula hyalostriata | genomic DNA | 6833 | taxon:1051367 | 4 | Norway:Bergen | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtggaaaattttatattttcctacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggatttgttttaaagcttcggcagagaagcaggttcttttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagtcaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcnttcggacagggtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI