Specimen 6737

Species "monothalamids" > Clade BM > Micrometula > Micrometula hyalostriata
Isolate number 6737
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2006
Habitat soft sediment
Depth 104m
Location Skagerrak
Latitude, Longitude 57.58, 11.1

Barcode sequences

SSU partial

>Micrometula hyalostriata | genomic DNA | 6737 | taxon:1051367 | 3 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtagaaaattttatattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggctttgttttaaagctttcgggtggagaagcaggtttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcaaacgaacagggtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Micrometula hyalostriata | genomic DNA | 6737 | taxon:1051367 | 7 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgnttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcagcctcttgttgcctttatttttaaaagcgtagaaaattttatattttcttacgcttgaaaaaggctttaaaactagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggctttgttttaaagctttcgggtggagaagcaggtttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcggacagggtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

SSU partial

>Micrometula hyalostriata | genomic DNA | 6737 | taxon:1051367 | 8 | Sweden:Skagerrak | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaaaagatacaagttttctttgtgagagcttgcattgtaaaatatgcgagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaacgatttaaaatgctatgttttctgtgtttgctgttcggttttagctcttacgggagtttttaactttgaacgcacacggcgtagcttaaaacaatcggaaagcaacgaacgtgaccgcaacctcttgttgcctttatttttaaaagcgtagaaaattttatattttcttacgcttgaaaaaggctttaaaattagagggaccgctgttctattctcttaaaccagaggaagattgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctattttcaaacgctaccgttgcggattttgtgagaagggggctttgttttaaagctttcgggtggagaagcaggtttctttttttcacaatttattccgcgttacgtgtcagctaaacctgcttcgaaagcaagtaggtaatcaattggaagtaacgatttccattttttggaaagcacaactttttggttcgtatggtactgcgaagttaacgcagtttactgtgtctttctctcgtcggtattcacacggatatctgtgctactatttttaaaattcaaggtggggacagaccattgttaattgttggtctcgttttaactaggaatgccttgtacgggttggttcatcaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactgggtcctttgcgacctacggaaactcattcggacagggtggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI