Specimen 3487

Species "monothalamids" > Clade CON > Conqueria > Conqueria laevis
Isolate number 3487
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on April 2002
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Conqueria laevis | genomic DNA | 3487 | taxon:1051369 | 1 | Antarctica:Weddell Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA atcttaccgggtccggacacactgaggattgacaggcgcttgtagttatgagattattaatttattaataattaaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactgtggacattgttataatagtgtgtgcacgcataacttcggttatgttgttgcctactgttccaaatgtcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcttccaaatacttattttattatcttttttgataattgagatcggtttatagaggctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcactgagcatctaattttattaaaagttcgtttggtttaatttgatcttaacagattaaataaaactaacgacatttcctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccacccgcacatactaatgtctcttgtagtaaccttgctttatttatcttttgatttatattgtcttgatttgttaccttgggacatgtgctccattaattcttggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggctctctttttgagctatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI