Specimen 1359

Species Miliolida > Peneroplidae > Peneroplis > Peneroplis planatus
Isolate number 1359
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 1999
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Peneroplis planatus | genomic DNA | 1359 | marine sediment sample | taxon:128053 | 7 | USA:Florida Keys | May-1999 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgatagtaatattattatataatattgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggtcgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagatatataattatataatatattatatagtaatatataatttaatattgtgctgccttatatattatttataaggattttaagtgaacatattttattatacatatattattatatatatttattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatatattatttatattataatatagcataaaattaaagggaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatctattataatacataatatgtttacatattataataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattcatacatatatggtatattaatattgtataatactatacattttatagtactattacaaataccattaattaatttaaggtggggatagtgtattgttaaataatacacttggccttaactaggaatgccttgtactcttctttggtttaacattccaagaggaatacgtccctgccctttgtacacaccgcccctcgctcttaccgatgaattatattataaatctaaaggacaaacagattcctaaattgaatacattgaatcttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI