Specimen 1370

Species "monothalamids" > Clade C1 > Toxisarcon > Toxisarcon synsuicidica
Isolate number 1370
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on April 1999
Habitat soft sediment
Location Sweden, Kosterfjorden, Yttre Vattenholmen

Barcode sequences

SSU partial

>Toxisarcon synsuicidica | genomic DNA | 1370 | taxon:169086 | Sweden:Kosterfjord | 16S rRNA | 16S rRNA | 16S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaacagcttttttttaagattatttttattttttaaaaaggcgttctcatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcaatggacttaataacaagttgcgctcttcttttctttgtggattttttacctgctttttgatatgcttttagtgagttttaacgtttttagaattgtttgaatttaccccagtttcggctgcgcgcgtacttttggacctttctctaaactattgcttttatgcgaatcgaggctatggtagaagtctgctatttatatgggaaaggattagtgcacattgagtcctgaaagcaacgaacgtgaccgcatccttttgttgccttctaactaaaccactattttttaatctttttttctttttaacttcgcggttatcaaagaatttaggattttaaaggttttaacaaagaaggctctattccctatattttaaaaatactgggaataaaactaaagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtaagcatctcatttcaaaaacgctgtttttcatagattttttatggctttctttttttatttttataagagaagttagctgtgaatgttaatagtcagtgaatttcagcttagcctgcttcgaaagttagcaggtaatcacttggaagtaatgatttcccttaattcaaaatttattttttgattatgcgagcacacaatgcgttgctctctgtcttgcttgggtagcaattacgtctactttttagctatacggcagagatgttccttactttttttttaataaaaatactgggaatttacaacgtgtgctttttgtcaattcatggtggggacagaccattgttaattattggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagctaccgctttaggggagacctcggttttctttttagcgatactataaacacttatggaaacttaaacgaacagtgtggtctaaaggaaaaagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Toxisarcon synsuicidica | genomic DNA | 1370 | taxon:169086 | 1 | Sweden:Kosterfjorden, Yttre Vattenholmen | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaacagcttttttttaagattatttttattttttaaaaaggcgttctcatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcaatggacttaataacaagttgcgctcttcttttctttgtggattttttacctgctttttgatatgcttttagtgagttttaacgtttttagaattgtttgaatttaccccagtttcggctgcgcgcgtacttttggacctttctctaaactattgcttttatgcgaatcgaggctatggtagaagtctgctatttatatgggaaaggattagtgcacattgagtcctgaaagcaacgaacgtgaccgcatccttttgttgccttctaactaaaccactattttttaatctttttttctttttaacttcgcggttatcaaagaatttaggattttaaaggttttaacaaagaaggctctattccctatattttaaaaatactgggaataaaactaaagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtaagcatctcatttcaaaaacgctgtttttcatagattttttatggctttctttttttatttttataagagaagttagctgtgaatgttaatagtcagtgaatttcagcttagcctgcttcgaaagttagcaggtaatcacttggaagtaatgatttcccttaattcaaaatttattttttgattatgcgagcacacaatgcgttgctctctgtcttgcttgggtagcaattacgtctactttttagctatacggcagagatgttccttactttttttttaataaaaatactgggaatttacaacgtgtgctttttgtcaattcatggtggggacagaccattgttaattattggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagctaccgctttaggggagacctcggttttctttttagcgatactataaacacttatggaaacttaaacgaacagtgtggtctaaaggaaaaagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI