Specimen 3213

Species "monothalamids" > Clade C > Rhizammina > Rhizammina algaeformis
Isolate number 3213
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 2001
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcaatgtgagatttatatctcatattataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcatgggacttataaataagtgtgctacttttcttgtttcgcttttatattttaacttatttataagttatttatgattgcgtttacaattatgaaatgtctgcgcacattaggtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttacttaaacgaacagtcttatttttaataaattcggctgtgagttttaacaaaagagtgctttataaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattataaaacgctgttttattgaccattatgatttattgttttggttgagcagccaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttttttaaaattcagattttaatttgtctttttgtgaagcacactatatgttgctcccttccctggccgtttgcttttttgtctttcggtctttagtggttgggtgttttttcaacatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagcttttacgttaaactaaaagctacaatcacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Rhizammina algaeformis | genomic DNA | 156 | taxon:525823 | small subunit ribosomal RNA ctcaaagattaagccangcaagtggntcttacctgacggtttgaataagtgttctcgcatagatttgatcagtttttgttccgttcatttctattctatttctgtcttttttacattgnctcacattcacttgtgcaactgcagatagctgcttaatacagtctcacttgtcttgacttggcattcgtttgctattcacatttcttctttctctctctctctttctaccatgtctgtgaaagcaattttggtgtgttcgcactgttaacacttcctactggataactaagggaaagtttggctaatacgtacgagantcacttttctcttctctcttctctcttctctctctctctctctctctctctctcatttgcacttattggtttgtggaccggatctttttgtatttctggtttcacagtagcctcatgantgacaataagaacgcactaagcaatctttctgagattgttgctgagcagacttgcaatcatctttttgcaagcatgtcatacaagcatctacagcatcaagtcacagngttggcaagtgtctttttgaaccttcaaagcagtcacgcatacggaggagtagtttctgatcccatagaaggagcaccgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgatagcctcttgtggacttatcatcttggacaagataaaacaaaactgattcgaattttccgttgaatgctttttgcnttcgtggtcttattcttcttacttctttctctttctctctctctctcttattctttatttctgtcttgttgacaccttcttgtttgacgatttggactggctcgttcacacgagttggtctgatcctttcattgaggcagtgacaagctgtaanttttgagtatgcttaaagaacgggtgtgtagacactgtcacttcgtgattcgtgactccgccnaatatgtgctcatttggnatgcggtgaatttaagtcattcggagtgagtggtgtccttgtttggacatcacaaacatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacacttttaatatgaaaacaaattttattctttttaatagaaatagatttgccttttttttattatacgacatacaattttacacacacatttatttttattatcatcattcttttttatttttcaacactgtgaacaaatcagagtgtaccaaacatgtcgttttacgataagtgcattgaatgtttcatcatggaatgttgcacttctaacatttttatatgtatatttttttngtcatttagttacactacacatttggttaacgtggcaataaaaggtatattattataaaaatatgtcgatggggatagttggagtcaagagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcacttgactaggctatactctttgtgaatattttcctttttaaattattacacacactattaattnttttaaatggaaatttcccactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccatttgttacatcaaacgatgggctctcaattgcatatacttttgaatgctattgccctcaacctgcaaaaattttgtggttcgagcttatgttatatttttatgacacgctcacctatttattttagtacggtttcgacggacatttcatttatatattttttgcgtgtaagtatttttaatattgcttgaaacattagcaatatgtgcctgcacatgattttctgagctttgcgctcatattatttggtgagatgtaagcactagacgtgggctactttcagcggctgtgcgcaggtattaatttatcgccgtagctttgtttgattgttcagcctttcgttattttaatggtgtgaagcacgcgttaggcacgcgcttactgcagaaatgtctgagacattccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcaatgtgagatttatatctcatattataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcatgggacttataaataagtgtgctacttttcttgtttcgcttttatattttaacttatttataagttatttatgattgcgtttacaattatgaaatgtctgcgcacattaggtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttacttaaacgaacagtcttatttttaataaattcggctgtgagttttaacaaaagagtgctttataaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattataaaacgctgttttattgaccattatgatttattgttttggttgagcagccaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttttttaaaattcagattttaatttgtctttttgtgaagcacactatatgttgctcccttccctggccgtttgcttttttgtctttcggtctttagtggttgggtgttttttcaacatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagcttttacgttaaactaaaagctacaatcacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI