Specimen 4643

Species "monothalamids" > Clade C > Hippocrepina > Hippocrepina indivisa
Isolate number 4643
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on July 2004
Habitat soft sediment
Location Svalbard

Barcode sequences

SSU partial

>Hippocrepina indivisa | genomic DNA | 4643 | taxon:1051372 | 2 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaatttttttattttcttataaaatatagttcacatataaatgatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacttgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataattttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcaggtaatcacttggaggtaatgatttcccttaactcaaacataaataatatttttgtttgttttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttgcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccg

See sequence on NCBI

SSU partial

>Hippocrepina indivisa | genomic DNA | 4643 | taxon:1051372 | 1 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagccgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaatttttttttatttttttataaaatatagttcacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacctgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccaraggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataatttttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcagtaatcacttggaagtagtgatttcccttaactcaaacataaataatatttttgtttgtttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccgcccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI