Specimen 4859

Species "monothalamids" > Clade C > Hippocrepina > Hippocrepina indivisa
Isolate number 4859
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 2004
Habitat soft sediment
Location Svalbard

Barcode sequence

SSU partial

>Hippocrepina indivisa | genomic DNA | 4859 | taxon:1051372 | 1 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaattttttttattttcttataaaatatagttcacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacttgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataatttttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcaggtaatcacttggaagtagtgatttcccttaactcaaacataaataatatttttgtttgttttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctc

See sequence on NCBI