Specimen 1188

Species "monothalamids" > Clade C2 > Gloiogullmia > Gloiogullmia sp.
Isolate number 1188
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Gloiogullmia sp. 1188 | genomic DNA | 1188 | taxon:164091 | 11 | single cell | Sweden:Tjaerno | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaatcgtttttatcttttaaaacattcgcatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtctcatactggacttagaaatcaagtgtgtttatttttcttgtgcggttatgttttaatgcattttgttaccccatttttttgggtgagtttcaatttgtgttttacattccgtgctttattgataaataaatacacatctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaaaacatttttttttattttttttactttaatttcttgttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttacagcactgttttcattttttttttaaaatgagcagtcaaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaatttatttttgattttgtgagcacacaatatgctgctcccctccctggcatttagctttttgtctatttgtcattgtgtgtggggatgctcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagttttttttattttttttttaatttgaaaaaagctataatcacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI