Specimen 71

Species Miliolida > Soritidae > Archaias > Archaias angulatus
Isolate number 71
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1995
Habitat soft sediment
Location Puerto Rico, Isla Magueyes

Barcode sequence

SSU partial

>Archaias sp. 71 MH-2008 | genomic DNA | 71 | marine sediment sample | taxon:577506 | 1 | Puerto Rico | Apr-1995 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtgacaggcgatagtttattatataataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttaatatataataatattttagttctgcctttatggatttaaagtgaacatattattattattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacattatatttattatataaattaaacctatttcgaaagtaaatgggcaatcatttaaaaatcgtgattattataatacacatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI