Specimen 7902

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7902
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 30m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequence

SSU partial

>Globocassidulina biora | genomic DNA | 7902 | taxon:1051365 | 15 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaattttttgcactttcgggtgtaattttttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccctgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI