Specimen 7962

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7962
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 35m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequences

SSU partial

>Globocassidulina biora | genomic DNA | 7962 | taxon:1051365 | 21 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttttgcactttcgggtgtaatttttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaagccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgcgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Globocassidulina biora | genomic DNA | 7962 | taxon:1051365 | 23 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatataattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaattttttgcactttcgggtgtaatttttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcaataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI