Specimen 2187

Species Rotaliida > Uvigerinidae > Trifarina > Trifarina earlandi
Isolate number 2187
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1999
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Trifarina earlandi | genomic DNA | 2187-1 | taxon:324130 | small subunit ribosomal RNA agaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatatacttttttgcattccttcgggtatgttaaatgtcatatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttanttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacntatgttgttattacactttgacccctccttcacgggtgcgtgtgtctttgactgtttcaactcatacaattangtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagtttttatgctcttacgtattaatttctgtgcaagaaagctttttaaactanagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttatatacaccgcatgcgcgagtccatttattcnntttctctaccttcacgggtatcgctgttttaaatgtgtatctctccgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgattcctttttttctgcacacatatatacggcagttatacccgggtaaccttgttgttacttttctgtgtgtatagctgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaacacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaattggattttatccacattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Trifarina earlandi | genomic DNA | 2187.3 | J. Pawlowski 2187 (UniGE) | taxon:324130 | small subunit ribosomal RNA | A10-6rA ctcaagattaagccatgcaagtggttacattaacccgacagtttaaataagtgttcattgctatccgcataacacgcacaatgcacatgtacgcataatacacacacatacacatctgttatgccgtacaagcattaggcataaattttgtttgcgatagtaacaaaatttcagcgtgaatcacacatacatacgcacagtgaatcacagcgaaattttacacatttcaacgtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcacacccacacacacatacacacacacacacacgatttctctgtaacgcatattcatacaagaagcacaattgcgttacaccgtgacactttttatcttttttatggataactcagggaaagtttggctaatacgtacgagtacatacacacacacacacacacacactcacacatatacactactcagcactcaatggtaaactttgatttacgcatattttatgcgtctatcagtttaaagtttaaccgcaacatgagagacattgagcacgcacgtgtaatgtgaattcgtctcacgttacacacctacgctgagcagactttgcgaagtttacttttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcatacttttattgcaatttactattatacgcattacgacactatttatagatttatttttattctgtcatacacacacacatccttgttcacacgcgtaaagtagaaattatatatatcatgtatattttatttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaaccttttaacggtgttacgtaaaaatttcactgttgatgtatctgaatttcaagtggagggcaagtctggtgc

See sequence on NCBI