Specimen 1145

Species Rotaliida > Uvigerinidae > Trifarina > Trifarina earlandi
Isolate number 1145
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Trifarina earlandi | genomic DNA | 1145-4b | taxon:324130 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatatacttttttcatattccttcgcgggttcgtgttaaatgtcatatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttattacactttgacccctccttcacgggtgcgtgtgtctttgactgtttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagtttttatgctcttacgtattaatttctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttatatacaccgcatgcgcgagtccatttattcagtttctctaccttcacgggtatcgctgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagttatacccgggtaaccttgttgttactttctgtgtgtatagctgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaattggattttatccacattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Trifarina earlandi | genomic DNA | 1145-3 | taxon:324130 | small subunit ribosomal RNA ggcatattaatatatacttttttctattccttcgggttcgtgttaaatgtctatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccattcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgatattacactttgacccctccttcacgggtgcgtgtgtctttgactgtttcaactcatacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagtttttatgctcttacatattaatttctgtgcaagaaagcttattaaaactaaagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataaacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaattgaattatttgcaagtgaagcatctcatatatatatatataacaccgcatgcgcgagtccatttattcagtttctctacccttcacgggtatcgctgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagttatacccgggtaaccttgttgttactttctgtgtgtatagctgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaattggatttatccacattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacc

See sequence on NCBI