Specimen 3966

Species Rotaliida > Incertae sedis > Nonionella > Nonionella labradorica
Isolate number 3966
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on May 2003
Location Skagerrak

Barcode sequence

SSU partial

>Nonionella labradorica | genomic DNA | 3966 | taxon:313611 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagctgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactaactatactcgtatatgtctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggcgcattttgttcacattcactttcgcttgcgtttgtgtattgtgtataattgtgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcatttattttcagttccattcatttggttctgtttttaagtgtgtttttgctctgcgcgcggtaaagcctacttcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgcagcttctgtgcgtatagatgttgaatacacactttttgtgttattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcacatatttgctttattgcattttttgcacgcctatggaaacttaaacgaacagtgtggtgtaaaggaaagagaagt

See sequence on NCBI

Other sequence

SSU partial

>Nonionella labradorica | genomic DNA | 3966 | taxon:313611 | 3966.27 | small subunit ribosomal RNA | s6-s14 region ccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgccatgaagaatgaatcttaacacctttctactctttgtgtcaacagttttacgtatatgttttgggcttatagttcatttcatatacgttcgacgctgttataagaattttgcttacgcatatacgatttttacacggcacgttagcatacacgcgtatatacaaccttacacatacacacccacatttcgttgtatataccgtgtgtgacacacgcagcacttaatttcagaaatgtcttttcgtttgcatttgtgtgtgagacacactttggagcatttattctcatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcgcactttcagccttttagaaagaagcctctcagcttttttctctctctcactatcacacatacacacacacacacacacacatcgtgaggaggcaaatactataagcgtatctttttttctaaaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattgtattacgctattagtatctctcacatacacacacacacacacacacatgtggtaacactaattatgcgtatatacattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttttacatcaaacgatgggctctcaattgcaatttctatatagaattgtaaatttcctcaacctgcaaaataacttggcttgagctcgtatcattcttgatacgctcgcctcacttttttcgtacggtctcgacggacgtttcattttatcattttctttgcgtgtaagcattatgtatttattccttgaaacataggaattacattgcgtgcacttgattttcggagctttgcgctcaaatttctggtgagatgtaagcactgtgtttctctgcccgcagcgtatgactatcggtcatttcgttctgtcgtttggtagtttaacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactactatactcgtatatgtgctgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccg

See sequence on NCBI