Specimen 1396

Species Rotaliida > Incertae sedis > Nonionella > Nonionella labradorica
Isolate number 1396
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 1999
Location Sweden, Tjärnö

Barcode sequence

SSU partial

>Nonionella labradorica | genomic DNA | 1396 | taxon:313611 | 1396.3 | small subunit ribosomal RNA | s14-sB region aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactaactatactcgtatatgtctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggcgcattttgttcacattcactttcgcttgcgtttgttgtattgtgtataattgtgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgccacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcattttatttcagttccattcatttggttctgtttttaagtgtgtttttgcttctgcgcgcggtaaagcctactttcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgcagcttctgtgcgtatagatgttgaatacacactttttgtgttattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcacatatttgctttattgcattttttgcacgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaaggcgtaacaaggcatcggtaggtga

See sequence on NCBI