Specimen 835

Species Miliolida > Soritidae > Broeckina > Broeckina sp.
Isolate number 835
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef sediment
Depth 30m
Location USA, Florida Keys, Conch reef
Latitude, Longitude 24.57, -80.27

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgactggcgatagtttattattctttagttaataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatacattaatatttagttctgccttaatttatatttcggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatttaattatatatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatataaaataatattttaatatattaataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaacattttaaaaatatataaattattttattgtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggaattatatattttattatttatgacaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Broeckina sp. 835 | genomic DNA | 835 | taxon:128056 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttagcatagttatagagatatagtttagttttggataactaagggaaagtttggctaatacgtttttaaaatgttattaatacacatttatgcatataataatattaattgcaacatgatagatattatataaatattttattcatttatttgaatataatatagagcagactttatatttattttaatataaagcatgtcaaacaaacatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgtatatattgaggcagtgacaagctgtaaagatttaatatattaattaagataacatttggaattgtcccttaataatatttatattattttggttgataatataccaatgttataaaatattaaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatattaatattttatatgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaaaataaaatatataataatatcaatactgtgaacaaaccagagtgtataaaacatgtaatattaattattagcaatgaatgttttatcatgggatattgcttatatatttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtactattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatatatataatattcattctcaactaataattaatatgattgagttatattattactctcatataaataaatgttgtttttgttaataaaacatgtattgattatatgtactttgcgctcatataattatataggtgagatgtaagcattattgatgattaatatactacatatataatatgtaagtattattataattcaaatataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgactggcgatagtttattattctttagttaataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatacattaatatttagttctgccttaatttatatttcggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatttaattatatatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatataaaataatattttaatatattaataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaacattttaaaaatatataaattattttattgtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggaattatatattttattatttatgacaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI