Specimen 4836

Species Rotaliida > Incertae sedis > Nonionella > Nonionella labradorica
Isolate number 4836
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 2004
Location Svalbard

Other sequence

SSU partial

>Nonionella labradorica | genomic DNA | 4836 | J. Pawlowski 4836 (UniGE) | taxon:313611 | small subunit ribosomal RNA | sA-s6 region ctcaaagattaagccatgcaagtggttacactaacccgacagtttaaataagtgttcaatgctttttccacatatatgatatatacggtctattcgttcacacatacacacacacaccacccgtgctgaacttagattccaacatatatatatatacacacattaagtgaatcactgaattctcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcatacgcgcaatgcatgaatatatacattacgtttcgactattttcgtaattgctcctttcgcctatgcactttacatggtcttccgtgtcgagtgtatctgcaccgggggtattttgtgaaatgcgtcaaatgtattcctattgaaatgcaatgcacggcttacctacacacacacatacacacactgtgatttctctgtttcgcttatctttatttcaaagattgctacgcgttacaccgtgacaacttcttttatttatggataactcagggaaagtttggctaatacgtacgagtatttacacacacacacacacacactctcacacagtgtatatatatatatattggttggtgcatacattttctcacacatcgtgtgtgtattcaaacagtatgtatatatatatgactccctctactcagcactcaatggtagacttttggtttcacgctctgcgtattccagtacaagtttaatcgcaacatgagagacattgagcacgcacgtgatttcgttccctcgggaacttagtcacattcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaattatatattgattattattatgcattatgcgcaaatttacaacatacattatgcaaatcattgtaacactacacacatacacaccctttttactctgtcatcatcatacatagcatatccttgttcgttgtttatttcagcattaaagcgtatatattattaacaccattatatacattcacttttttactgaggcagtgacaagctgtaacggttgagtatttaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttattctctgtaatttcactgttcatgtatctgaatttcaagtggagggcaagtctggtgc

See sequence on NCBI