Specimen 1148

Species Rotaliida > Incertae sedis > Pullenia > Pullenia subcarinata
Isolate number 1148
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Pullenia subcarinata | genomic DNA | 1850 | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgccgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgaccccttcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaacatgttttgtttatgtctttatanntnttcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaacccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148.56 | J. Pawlowski 1148 (UniGE) | taxon:325275 | small subunit ribosomal RNA | A10-6rA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtaaactttgagtgcgctcgcgcattcagtataaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacgggagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtattcacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgtt

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148.2b | J. Pawlowski 1148 (UniGE) | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctggttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaagccacccggaatacgtccctgccctttgtacacaccgcccgtcgct

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148.57 | J. Pawlowski 1148 (UniGE) | taxon:325275 | small subunit ribosomal RNA | A10-6rA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtaaactttgattgcgttcgcgcattcagtttaaagtataactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaaccttcgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgc

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148 | taxon:325275 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtaaactttgattgcgttcgcgcattcagtttaaagtataactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaaccttcgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcnnnnnnnnggctcgacgttggattgaactgcaatatgaatgaattcttatcattcagttttgaagttttacgcttaaccttaaatttccaaatttttggttttgcgttcgacgctgttaaaattcttacaatttcacggttgtactaattttttttacacggcacaaatttttcctgccgccgcttcgtatatatattttcctcatacacacataccactgggataaatatacgacgcagcatttttacacacacacacacaacgcgggaaatctttggaactcatgacactcatagaatttattctcctttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatggcttatcatgggatgttgcactttcgccatagaaattttttactgcatcttacgtgccgtaaatattttctcacacacacacacacacacacgtacatgtttacatagcccacgtattaaatttttatcaacggtaaattttttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactcttttgtgattatttatttatgtgttacgccactaatttatacacacacacacacacgcaaatattttttagcggcacacacatttatattatatatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcagcctacaaaataacttggcttgagctcgtatttttatacgctcgcctaaattttttcgtacggtctcgatggacgtttcatttaaaatttttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactgtgtcatattacccgcagcgtatagcttcggctatttcgtctgtcgtgtgtagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcgacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagctgcttcgaaagtaagtgggtaatcaattagaagtaatgaatttcctttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1148 | taxon:325275 | 1148.1c | small subunit ribosomal RNA | s14-sB region cactgaggattgacaggcaatattagtacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttacagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccctagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcgattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcttggttcaacaaaccacccggaatacg

See sequence on NCBI