Specimen 1850

Species Rotaliida > Incertae sedis > Pullenia > Pullenia subcarinata
Isolate number 1850
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1999
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Pullenia subcarinata | genomic DNA | 1850.4b | J. Pawlowski 1850 (UniGE) | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgctgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgtttatgtcttcatagatattcatgaaaagaggcttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgaggga

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1850.26 | J. Pawlowski 1850 (UniGE) | taxon:325275 | small subunit ribosomal RNA | A10-6rA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtacactttgagtgcgttcgcgcattcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtatactgtgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtacattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgc

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1850 | taxon:325275 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgccgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattttacgtgtgttgcagcactttgaccccttcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaacatgttttgtttatgtctttatanntnttcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaacccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1850.7 | J. Pawlowski 1850 (UniGE) | taxon:325275 | small subunit ribosomal RNA | A10-6rA ctcaaagattcggccgcactagtggatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtaaactttgagtgcgttcgcgcattcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtatactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcgagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgc

See sequence on NCBI

SSU partial

>Pullenia subcarinata | genomic DNA | 1850 | taxon:325275 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatgcaatatcacgcacacacacacacacatatgattttgtttacagtagtaacaatttcagcgtgaatcacaccatcacacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaatatttcattcaatacactgcttaaacgcagtgcagagggtgaatttttttattttgttgcatcacacgcacaaaattttttgatttctctgtatcgcttattctcaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaatatacctcacacacacacacacaattcaaaattttttgttttgcgccgtgtatcgacaacacacacacacacacacaatcactactcagcactcagtggtacactttgagtgcgttcgcgcattcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtacttcacatcacgctgagcagactttgcgaagtatactgtgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtacattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaacaaagtttattacacacatataacactatattttttctgttacccaacagaatttatttattctaaacatccttgttcgttgtttattcagcacgatgatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaatatgaatgattcttatcattcagttttgaagttttacgcttaaccttaaatttccaaatttttggttttgcgttcgacgctgttaaaattcttacaatttcacggttgtactaattttttttacacggcacaaattttttctgccgccgcttcgtatatatattttcctcatacacacataccactgggataaatatacgacgcagcatttttacacgcacacacacaacgcgggaaatctttggaactcatgacactcatagaatttattctcctttcatcnctgtgaacaaatcaagtgtatcaaacatgtcrtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcgccatagaaattttttactgcatcttacgtgacgaaaatattttctcacacacacacacacacacacgtacatgtttacatagccacgtattaaatttttatcaacggtaaattttttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatttatttatgtgttacgccactaatttatacacacacacacacacgcaaatattttttagcggcacacacatttatattatatatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcagcctacaaaataacttggcttgagctcgtatttttatacgctcgcctaaattttttcgtacggtctcgatggacgtttcatttaaaatttttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcactcaattctggtgagatgtaagcactgtgtcatattacccgcagcgtatagcttcggctatttcgtctgtcgtgtgtagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtcagttcgccgtgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataattcttacgtgtgttgcagcactttgacccctcagcaatgagcgcgcgtcttagtttgcttgctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaacatgttttgtttatgtctttatagatattcatgaaaaaaggcttttaaactagagggaccgctgttactttcttaaacccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcgtgttcgcacgttttaaatatgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagatttatctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI