Specimen 3599

Species Rotaliida > Incertae sedis > Bulimina > Bulimina marginata
Isolate number 3599
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 2002
Location Oslofjord, Norway

Barcode sequences

SSU partial

>Bulimina marginata | genomic DNA | 3599 | taxon:313259 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattagcacttagcttcggcgacgtgttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcctaattgcgtttcaccaagggcctataattttacgtgtgttgcggcaccttgacccctntttttttaaagagcgcgtgtcttggtttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacgtgcatatgtaatttttttaaattgctttgcgcgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagaccatttattcaccttcgggtgctttaaatgtgttttctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcgaagttatttttataacatacgcacctgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatc

See sequence on NCBI

SSU partial

>Bulimina marginata | genomic DNA | 3599 | taxon:313259 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacattacactctcacgcacacacacacacacacacacacgagattcgttacggtagtaacaatttcagcgtgaatcacctttacacagtgaatcactgaaattacccattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtcatttcaaacaggagagagaatttattttttcccgcctgctttgaattgcatactatcacacatgctgattgttgcaatcattcgatttctctgtatcgcttattctcaaaggacatgcgttacaccgtgacaattttcttttatggataactcagggaaagtttggctaatacgtacgagtatcacacacacacacacactcgcacacattttatgattcgctctcacgtggcgacgtatctttttctctcacacacactacaccccgaatcgattacrtaccgcgagagatcacacagtgtttcattttttatgtgtctgcaacacatcaactactcarcactcaatggtaaactttggccgcgttcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtgacttcggtcacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatttattatcattttgtattactattgcgttatacaacaatttacaacacacacacactagatgtgatgtaatatatatagcactatattttaattctgtcacctacacacagaaatacatccttgttcgttgttttttttcacgtaacgcaaaaagtcaatttcttgattttatgtttttactgaggcagtggcaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttcacgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaaacttgagtgaattctatttcatctcgattttgtgagtaacttacgcgtaactttttttttatagattcgcacctcgcgtctctttagatttttaattttatgcgttcgacgctgtttagaacacacgctaaattttttacacggcactcactcgcctttagaatttattctcatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagccttaggaagaaattccactgcatacgttctcgcacacacacacacacaccgcagctcatatgcaggcgacgcacatgttaataccgccgcgtagatttttatttcttcttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatattttttttatgcacacagcacacagcatacacacacacacacacatactgtgtcgccccgtgtctcaaaaaatatatacactttacaatgaagaacgaagggttgggagatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttctcgtaaattgcaaatttcctcagctacaaaatgaattggcttgagctcgtattattcgtaatacgctcgcctcactattttcgtacggtctcgatggacgtttcatttatatttttttgcgtgtaagcattatgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgtcatactgcccgcagcgtatgccttcgggcatttcgttctgtcgtgtgtagttgacaattttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccttccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattagcacttagcttcggcgacgtgttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcctaattgcgtttcaccaagggcctataattttacgtgtgttgcggcaccttgacccctctttttttaaagagcgcgtgtcttggtttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacgtgcatatgtaatttttttaaattgctttgcgcgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagaccatttattcaccttcgggtgctttaaatgtgttttctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcgaagttatttttataacatacgcacctgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI