Specimen 523

Species Rotaliida > Incertae sedis > Bulimina > Bulimina marginata
Isolate number 523
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 1997
Location Sweden, Tjärnö

Barcode sequence

SSU partial

>Bulimina marginata | genomic DNA | 523 | taxon:313259 | small subunit ribosomal RNA ttaccgggtccggcacactgaggattgacaggcaatattagcacttagcttcttgcgacgggttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaccaagggcctataattttacgtgtgttgcggcactttgacccctctttttttaaagagcgcgggtcttggttngcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacgggcatatgnaattttttnaaattgctttgcgcgcaaaaaggntttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggnctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcaggagcatctcattttttacacaccgcatacgcgagaccatttattcaccttcgggtgctttaaatgtgttttctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcgaagttatttttataacatacgcacctgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctg

See sequence on NCBI