Specimen 251

Species Rotaliida > Calcarinidae > Neorotalia > Neorotalia calcar
Isolate number 251
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on August 1996
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

>Neorotalia calcar | genomic DNA | 251 (Okinawa, Japan) | taxon:75328 | 13 | SSU rRNA | SSU rRNA | small subunit ribosomal RNA | includes variable area V5 and flanking helices 24 and 25 and parts of flanking helices 21, 22, 26 and 28 (Neefs et al., 1990) ctaccaaaagcgaaagcagttggctaggctatactctttgtctcacactctgtatcacacacacatcacacacagagagtgacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttcttttataagattgcaaacactcctcaacctacaaaatgacttggcttgagctcgtatctctgatacgctcgctagactattttcgtacggtctcgatggacgtttcattttattctattttttgcgtgtaagcattgtaaattattctttgaacataagaattttactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgttaactgttacccgcagtgtataactatcggttatttcacttgtcgtgtttgtaacaataacaatttcggtgtgaagcacgctttaggcacgcgcttactgcagaaat

See sequence on NCBI

Other sequence

LSU partial

>Neorotalia calcar | genomic DNA | 251 (Okinawa, Japan) | taxon:75328 | 7 | LSU rRNA | LSU rRNA | large subunit ribosomal RNA | includes divergent domain D1 and flanking regions of conserved domains C1 and C2 (Hassouna et al., 1984) cgtaataatagaaactaaccgggattcccttagtaacggcgagtgaactgggaagtagtgcgtgcgattaattcactctgtgatttattcgcagctcagcccgtcgatataatccattcttagcgtgcagttacttcggtatctctcgctggaaggaattgtagcatcgaatacacattcaagttgtatcacgcatcagacactcatacgctcctacagtctcgcatacacatcactggttgaaacacacagcgtttagcgttggaaagcaattattgtagtttcactacagccatagagtgtgacagccacgttttatggagtgataaccatatgcagacacacaccgcgtcgatacgtaattcgtgaatgttgaacctgagcgagttgttt

See sequence on NCBI